Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01474
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01474
Clone name ek00114
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PLAA
cDNA sequence DNA sequence (2654 bp)
Predicted protein sequence (828 aa)
Flexi ORF Clone FXC01474
Description phospholipase A2-activating protein
Features of the cloned cDNA sequence

Length: 2654 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 167 bp
Genome contig ID gi89161216r_26795342
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
GGGAGGGGAAACAGAAATAAAATTTTTGCACTGCT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
GAACTGTGAGATTTTCCTGTGTAATTTGGGTAGATTTTCAAGAGTGTGAA

Features of the protein sequence

Length: 828 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y263 0 100.0 Phospholipase A...
 Homo sapiens
XP_520517 0 99.8 hypothetical pr...
 Pan troglodytes
BAA91803 0 99.8 unnamed protein...
 Homo sapiens
XP_001105698 0 98.8 similar to phos...
 Macaca mulatta
BAE87781 0 98.3 unnamed protein...
 Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 179 211 PD000018 WD40 repeat
IPR001680 259 291 PD000018 WD40 repeat
FPrintScan IPR001680 159 173 PR00320 WD40 repeat
IPR001680 199 213 PR00320 WD40 repeat
IPR001680 279 293 PR00320 WD40 repeat
HMMPfam IPR001680 41 80 PF00400 WD40 repeat
IPR001680 88 131 PF00400 WD40 repeat
IPR001680 135 172 PF00400 WD40 repeat
IPR001680 174 212 PF00400 WD40 repeat
IPR001680 214 251 PF00400 WD40 repeat
IPR001680 254 292 PF00400 WD40 repeat
IPR001680 294 331 PF00400 WD40 repeat
IPR015155 377 494 PF09070 PFU (PLAA family ubiquitin binding)
IPR013535 566 824 PF08324 PUL
HMMSmart IPR001680 40 80 SM00320 WD40 repeat
IPR001680 87 131 SM00320 WD40 repeat
IPR001680 134 172 SM00320 WD40 repeat
IPR001680 173 212 SM00320 WD40 repeat
IPR001680 213 251 SM00320 WD40 repeat
IPR001680 253 292 SM00320 WD40 repeat
IPR001680 293 331 SM00320 WD40 repeat
ProfileScan IPR001680 47 340 PS50294 WD40 repeat
IPR001680 141 171 PS50082 WD40 repeat
IPR001680 180 212 PS50082 WD40 repeat
IPR001680 260 292 PS50082 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp