ORK01475

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01475

Order Kazusa clone(s) from :

Accession No	AB209746
Product ID	ORK01475
Clone name	ek00180
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	WDR1
cDNA sequence	DNA sequence (2743 bp) Predicted protein sequence (624 aa)
HaloTag ORF Clone	FHC01475
Flexi ORF Clone	FXC01475
Description	WD repeat protein 1 (Actin-interacting protein 1) (AIP1) (NORI-1).

Features of the cloned cDNA sequence

Description

Length: 2743 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	866 bp
Genome contig ID	gi89161207r_9585234
PolyA signal sequence (None)	+--------+--------+----*----+---- CTAATCTGTCATTGTTTTTACCTTCCTTTTCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCAGTGCAGAAATTAAAAGTAAGTATAAAGCACCGTGATTGGGAGTGTTT

Features of the protein sequence

Description

Length: 624 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92983	100.0	WD repeat-conta...	Homo sapiens
AAH00201	100.0	WD repeat domai...	Homo sapiens
O75083	99.8	WD repeat-conta...	Homo sapiens
BAD96484	99.8	WD repeat-conta...	Homo sapiens
XP_001158647	99.5	WD repeat-conta...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	249	281	PD000018	WD40 repeat
BlastProDom	IPR001680	545	577	PD000018	WD40 repeat
FPrintScan	IPR001680	91	105	PR00320	WD40 repeat
	IPR001680	267	281	PR00320	WD40 repeat
	IPR001680	355	369	PR00320	WD40 repeat
HMMPfam	IPR001680	66	104	PF00400	WD40 repeat
	IPR001680	154	193	PF00400	WD40 repeat
	IPR001680	197	235	PF00400	WD40 repeat
	IPR001680	242	280	PF00400	WD40 repeat
	IPR001680	328	368	PF00400	WD40 repeat
	IPR001680	469	491	PF00400	WD40 repeat
	IPR001680	497	535	PF00400	WD40 repeat
	IPR001680	540	578	PF00400	WD40 repeat
HMMSmart	IPR001680	65	104	SM00320	WD40 repeat
	IPR001680	109	152	SM00320	WD40 repeat
	IPR001680	153	193	SM00320	WD40 repeat
	IPR001680	196	235	SM00320	WD40 repeat
	IPR001680	238	280	SM00320	WD40 repeat
	IPR001680	327	368	SM00320	WD40 repeat
	IPR001680	372	410	SM00320	WD40 repeat
	IPR001680	452	491	SM00320	WD40 repeat
	IPR001680	496	535	SM00320	WD40 repeat
	IPR001680	539	578	SM00320	WD40 repeat
	IPR001680	582	621	SM00320	WD40 repeat
ProfileScan	IPR001680	72	113	PS50082	WD40 repeat
	IPR001680	72	624	PS50294	WD40 repeat
	IPR001680	203	244	PS50082	WD40 repeat
	IPR001680	248	289	PS50082	WD40 repeat
	IPR001680	334	377	PS50082	WD40 repeat
	IPR001680	546	587	PS50082	WD40 repeat
ScanRegExp	IPR001680	267	281	PS00678	WD40 repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	432	AVGPGGYAVVVCIGQIVLLKDQ	453	PRIMARY	22