Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01477
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01477
Clone name bg00212
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol GSK3B
cDNA sequence DNA sequence (7031 bp)
Predicted protein sequence (426 aa)
Flexi ORF Clone FXC01477
Description glycogen synthase kinase 3 beta
Features of the cloned cDNA sequence

Length: 7031 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4828 bp
Genome contig ID gi89161205r_120923494
PolyA signal sequence
(AATAAA,-32)
+----*----+----*----+----*----+----
TTAAATAAAAAGTAGGTTAGCCTGGAAATGAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATTCACAAGTGTGTGGTCTTTATTTCAGTACCCAACCCTCTTCCTTC

Features of the protein sequence

Length: 426 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P49841 5.5e-168 100.0 Glycogen syntha...
Homo sapiens
1PYX 5.5e-168 100.0 Glycogen syntha...
Homo sapiens
XP_856611 1.1e-167 99.7 similar to Glyc...
Canis lupus fam...
1Q3D 1.5e-167 100.0 GLYCOGEN SYNTHA...
Homo sapiens
AAA66475 1.7e-167 99.7 protein kinase ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 66 346 PD000001 Protein kinase
HMMPfam IPR000719 62 346 PF00069 Protein kinase
HMMSmart IPR001245 62 346 SM00219 Tyrosine protein kinase
IPR002290 62 346 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 62 346 PS50011 Protein kinase
ScanRegExp IPR000719 68 92 PS00107 Protein kinase
IPR008271 183 195 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp