ORK01480

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01480

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01480
Clone name	bj00162
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	SATB1
cDNA sequence	DNA sequence (3817 bp) Predicted protein sequence (797 aa)
HaloTag ORF Clone	FHC01480
Flexi ORF Clone	FXC01480
Description	SATB homeobox 1

Features of the cloned cDNA sequence

Description

Length: 3817 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	422 bp
Genome contig ID	gi89161205r_18265244
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCACACTGATCTTTGGAAACTTGCCCCTTATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAGAAAAAAAAGAGTTTGTTACTCTATTGTATGTTACAAA

Features of the protein sequence

Description

Length: 797 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92998	100.0	special AT-rich...	Homo sapiens
BAG10908	100.0	DNA-binding pro...	synthetic construct
XP_001086749	99.6	special AT-rich...	Macaca mulatta
EDL83029	97.6	rCG23620, isofo...	Rattus norvegicus
EDL23651	97.6	special AT-rich...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003350	364	450	PF02376	Homeodomain protein CUT
	IPR003350	486	573	PF02376	Homeodomain protein CUT
	IPR001356	679	736	PF00046	Homeobox
HMMSmart	IPR001356	678	741	SM00389	Homeobox
ProfileScan	IPR003350	363	450	PS51042	Homeodomain protein CUT
	IPR003350	486	573	PS51042	Homeodomain protein CUT
	IPR001356	676	737	PS50071	Homeobox

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp