ORK01487

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01487

Order Kazusa clone(s) from :

Accession No	AB209770
Product ID	ORK01487
Clone name	bm01247
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ANXA11
cDNA sequence	DNA sequence (2005 bp) Predicted protein sequence (510 aa)
Flexi ORF Clone	FXC01487
Description	Annexin A11 (Annexin-11) (Annexin XI) (Calcyclin-associated annexin 50) (CAP-50) (56 kDa autoantigen).

Features of the cloned cDNA sequence

Description

Length: 2005 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	255 bp
Genome contig ID	gi89161187r_81805334
PolyA signal sequence (AATAGA,-21)	+--------+--------+----*----+---- CCTCTTGCTGCTAAAATAGATGTTTCATTTTTCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCATGCAATCATTCCCCTTTGCCTGTGGCTAAGACTTGGCTTCATTTC

Features of the protein sequence

Description

Length: 510 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93007	3e-135	100.0	annexin A11 var...	Homo sapiens
CAG29319	4.4e-134	100.0	ANXA11 [Homo sa...	Homo sapiens
AAX41291	1.6e-133	99.8	annexin A11 [sy...	synthetic construct
P50995	2.1e-133	99.8	Annexin A11; An...	Homo sapiens
BAE87371	6.2e-131	98.0	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001464	210	277	PD000143	Annexin
	IPR001464	281	349	PD000143	Annexin
	IPR001464	365	433	PD000143	Annexin
	IPR001464	440	508	PD000143	Annexin
FPrintScan	IPR008157	39	53	PR01810	Annexin
	IPR008157	56	70	PR01810	Annexin
	IPR008157	101	111	PR01810	Annexin
	IPR008157	172	184	PR01810	Annexin
	IPR008157	187	197	PR01810	Annexin
	IPR001464	219	241	PR00196	Annexin
	IPR001464	259	275	PR00196	Annexin
	IPR001464	286	307	PR00196	Annexin
	IPR001464	369	395	PR00196	Annexin
	IPR001464	449	469	PR00196	Annexin
	IPR001464	493	506	PR00196	Annexin
HMMPfam	IPR001464	209	274	PF00191	Annexin
	IPR001464	281	346	PF00191	Annexin
	IPR001464	364	430	PF00191	Annexin
	IPR001464	440	505	PF00191	Annexin
HMMSmart	IPR001464	222	274	SM00335	Annexin
	IPR001464	294	346	SM00335	Annexin
	IPR001464	378	430	SM00335	Annexin
	IPR001464	453	505	SM00335	Annexin
ScanRegExp	IPR001464	294	346	PS00223	Annexin
	IPR001464	378	430	PS00223	Annexin
	IPR001464	453	505	PS00223	Annexin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp