Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01502
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01502
Clone name bm02930
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TAF7
cDNA sequence DNA sequence (2271 bp)
Predicted protein sequence (362 aa)
Flexi ORF Clone FXC01502
Description Transcription initiation factor TFIID subunit 7 (Transcription initiation factor TFIID 55 kDa subunit) (TAF(II)55) (TAFII-55) (TAFII55).
Features of the cloned cDNA sequence

Length: 2271 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 503 bp
Genome contig ID gi51511721r_140578243
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CCAATACAATAAATAAAAGCATCTGTTTTTCACTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TATAGTGTATCTTGTTCTTTCATGGTTGGTGGGAGTCAGGTCCTCTTGTG

Features of the protein sequence

Length: 362 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q15545 1.1e-113 100.0 Transcription i...
Homo sapiens
AAB60347 4.7e-113 99.4 TFIID subunit T...
Homo sapiens
XP_544308 8.7e-113 98.8 similar to TATA...
Canis lupus fam...
Q2HJG8 1.3e-111 97.7 Transcription i...
Bos taurus
Q6R1L1 1.6e-107 95.4 Transcription i...
Cricetulus griseus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006751 25 191 PF04658 TAFII55 protein conserved region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp