ORK01504

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01504

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01504
Clone name	bm03192
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	KLHL22
cDNA sequence	DNA sequence (2474 bp) Predicted protein sequence (644 aa)
HaloTag ORF Clone	FHC01504
Flexi ORF Clone	FXC01504
Description	Kelch-like protein 22.

Features of the cloned cDNA sequence

Description

Length: 2474 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	539 bp
Genome contig ID	gi89161203r_19025821
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CATGTTGTTGGTCAATGAAATAAAGCATCTTACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGTGTTAACTGTTTTTCTGTAGCCACAGCCTCAGTTCCTTTCCACAGT

Features of the protein sequence

Description

Length: 644 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q53GT1	100.0	Kelch-like prot...	Homo sapiens
BAD96570	99.8	kelch-like vari...	Homo sapiens
XP_001083348	99.8	similar to kelc...	Macaca mulatta
XP_543559	98.4	similar to kelc...	Canis lupus fam...
XP_001488237	98.2	kelch-like 22 (...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	50	157	PF00651	BTB/POZ
	IPR011705	162	268	PF07707	BTB/Kelch-associated
	IPR006652	348	396	PF01344	Kelch repeat type 1
	IPR006652	398	443	PF01344	Kelch repeat type 1
	IPR006652	445	490	PF01344	Kelch repeat type 1
	IPR006652	492	541	PF01344	Kelch repeat type 1
	IPR006652	543	590	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	60	157	SM00225	BTB/POZ-like
	IPR006652	309	359	SM00612	Kelch repeat type 1
	IPR006652	360	409	SM00612	Kelch repeat type 1
	IPR006652	410	456	SM00612	Kelch repeat type 1
	IPR006652	457	503	SM00612	Kelch repeat type 1
	IPR006652	504	554	SM00612	Kelch repeat type 1
	IPR006652	555	603	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	60	127	PS50097	BTB/POZ-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp