Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01506
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01506
Clone name bm03222
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PPP2CA
cDNA sequence DNA sequence (1662 bp)
Predicted protein sequence (355 aa)
Flexi ORF Clone FXC01506
Description Serine/threonine-protein phosphatase 2A catalytic subunit alpha isoform (EC 3.1.3.16) (PP2A-alpha) (Replication protein C) (RP-C).
Features of the cloned cDNA sequence

Length: 1662 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 531 bp
Genome contig ID gi51511721r_133460831
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
ATTATATGATTTGTCTGCACTCAGTTTATTCCCTA
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
CTCAAATCTCAGCCCCATGTTGTTCTTTGTTATTGTCAGAACCTGGTGAG

Features of the protein sequence

Length: 355 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001371054 7.6e-137 92.5 hypothetical pr...
 Monodelphis dom...
P67776 3.5e-135 100.0 Serine/threonin...
 Sus scrofa
AAP36249 3.5e-135 100.0 protein phospha...
 synthetic construct
3C5W 3.5e-135 100.0

AAX46574 6.5e-135 99.6 protein phospha...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR006186 123 153 PD000252 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
FPrintScan IPR006186 97 124 PR00114 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
IPR006186 126 153 PR00114 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
IPR006186 159 183 PR00114 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
IPR006186 194 220 PR00114 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
IPR006186 223 250 PR00114 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
IPR006186 279 299 PR00114 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
IPR006186 301 317 PR00114 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
HMMPfam IPR004843 96 291 PF00149 Metallophosphoesterase
HMMSmart IPR006186 69 339 SM00156 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
ScanRegExp IPR006186 160 165 PS00125 Serine/threonine-specific protein phosphatase and bis(5-nucleosyl)-tetraphosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp