Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01508
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226087
Product ID ORK01508
Clone name bm03741
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FBXO7
cDNA sequence DNA sequence (2065 bp)
Predicted protein sequence (557 aa)
Flexi ORF Clone FXC01508
Description F-box only protein 7.
Features of the cloned cDNA sequence

Length: 2065 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 298 bp
Genome contig ID gi89161203f_31100792
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
TGCTGTTCTTACCAGATTAAAAAAAAGTGTAAATT
Flanking genome sequence
(124025 - 124074)
----+----*----+----*----+----*----+----*----+----*
ACATGGTGGTCTTGACTTTTATTACAGAAAGATATGTAGTAAATATTCAG

Features of the protein sequence

Length: 557 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH08361 1.6e-190 100.0 F-box protein 7...
Homo sapiens
Q9Y3I1 2.4e-190 99.8 F-box only prot...
Homo sapiens
BAF84661 3.5e-190 99.6 unnamed protein...
Homo sapiens
EAW60026 4e-190 99.6 F-box protein 7...
Homo sapiens
XP_001153721 4.7e-188 98.8 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001810 365 412 PF00646 Cyclin-like F-box
HMMSmart IPR001810 370 410 SM00256 Cyclin-like F-box
ProfileScan IPR001810 364 410 PS50181 Cyclin-like F-box
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp