Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01509
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01509
Clone name bm03760
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF133
cDNA sequence DNA sequence (2199 bp)
Predicted protein sequence (675 aa)
Flexi ORF Clone FXC01509
Description Zinc finger protein 133 (Zinc finger protein 150).
Features of the cloned cDNA sequence

Length: 2199 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 170 bp
Genome contig ID gi51511747f_18117201
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTGGCCTTCGGTTGTAATAAACTTGGCTTCTTTAT
Flanking genome sequence
(128431 - 128480)
----+----*----+----*----+----*----+----*----+----*
ACATCTGTAACTGTGCCTGTGTCCCTCATTCACTCATCTATAACAGGGAT

Features of the protein sequence

Length: 675 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX10249 0 99.8 zinc finger pro...
Homo sapiens
AAH01887 0 100.0 Zinc finger pro...
Homo sapiens
CAI21835 0 99.8 zinc finger pro...
Homo sapiens
AAC50260 0 99.8 zinc finger pro...
Homo sapiens
P52736 0 99.6 Zinc finger pro...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 292 314 PD000003 Zinc finger
IPR007087 319 342 PD000003 Zinc finger
IPR007087 347 369 PD000003 Zinc finger
IPR007087 376 398 PD000003 Zinc finger
IPR007087 403 426 PD000003 Zinc finger
IPR007087 431 454 PD000003 Zinc finger
IPR007087 459 482 PD000003 Zinc finger
IPR007087 489 510 PD000003 Zinc finger
IPR007087 517 538 PD000003 Zinc finger
IPR007087 543 565 PD000003 Zinc finger
IPR007087 600 622 PD000003 Zinc finger
IPR007087 627 648 PD000003 Zinc finger
HMMPfam IPR001909 23 63 PF01352 KRAB box
IPR007087 235 257 PF00096 Zinc finger
IPR007087 263 285 PF00096 Zinc finger
IPR007087 291 313 PF00096 Zinc finger
IPR007087 319 341 PF00096 Zinc finger
IPR007087 347 369 PF00096 Zinc finger
IPR007087 375 397 PF00096 Zinc finger
IPR007087 403 425 PF00096 Zinc finger
IPR007087 431 453 PF00096 Zinc finger
IPR007087 459 481 PF00096 Zinc finger
IPR007087 487 509 PF00096 Zinc finger
IPR007087 515 537 PF00096 Zinc finger
IPR007087 543 565 PF00096 Zinc finger
IPR007087 571 593 PF00096 Zinc finger
IPR007087 599 621 PF00096 Zinc finger
IPR007087 627 652 PF00096 Zinc finger
HMMSmart IPR001909 23 83 SM00349 KRAB box
IPR015880 235 257 SM00355 Zinc finger
IPR015880 263 285 SM00355 Zinc finger
IPR015880 291 313 SM00355 Zinc finger
IPR015880 319 341 SM00355 Zinc finger
IPR015880 347 369 SM00355 Zinc finger
IPR015880 375 397 SM00355 Zinc finger
IPR015880 403 425 SM00355 Zinc finger
IPR015880 431 453 SM00355 Zinc finger
IPR015880 459 481 SM00355 Zinc finger
IPR015880 487 509 SM00355 Zinc finger
IPR015880 515 537 SM00355 Zinc finger
IPR015880 543 565 SM00355 Zinc finger
IPR015880 571 593 SM00355 Zinc finger
IPR015880 599 621 SM00355 Zinc finger
IPR015880 627 652 SM00355 Zinc finger
ProfileScan IPR001909 23 94 PS50805 KRAB box
IPR007087 235 262 PS50157 Zinc finger
IPR007087 263 290 PS50157 Zinc finger
IPR007087 291 318 PS50157 Zinc finger
IPR007087 319 346 PS50157 Zinc finger
IPR007087 347 374 PS50157 Zinc finger
IPR007087 375 402 PS50157 Zinc finger
IPR007087 403 430 PS50157 Zinc finger
IPR007087 431 458 PS50157 Zinc finger
IPR007087 459 486 PS50157 Zinc finger
IPR007087 487 514 PS50157 Zinc finger
IPR007087 515 542 PS50157 Zinc finger
IPR007087 543 570 PS50157 Zinc finger
IPR007087 571 598 PS50157 Zinc finger
IPR007087 599 626 PS50157 Zinc finger
IPR007087 627 652 PS50157 Zinc finger
ScanRegExp IPR007087 237 257 PS00028 Zinc finger
IPR007087 265 285 PS00028 Zinc finger
IPR007087 293 313 PS00028 Zinc finger
IPR007087 321 341 PS00028 Zinc finger
IPR007087 349 369 PS00028 Zinc finger
IPR007087 377 397 PS00028 Zinc finger
IPR007087 405 425 PS00028 Zinc finger
IPR007087 433 453 PS00028 Zinc finger
IPR007087 461 481 PS00028 Zinc finger
IPR007087 489 509 PS00028 Zinc finger
IPR007087 517 537 PS00028 Zinc finger
IPR007087 545 565 PS00028 Zinc finger
IPR007087 573 593 PS00028 Zinc finger
IPR007087 599 621 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp