Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01510
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01510
Clone name bm03840
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol URI1
cDNA sequence DNA sequence (2537 bp)
Predicted protein sequence (566 aa)
Flexi ORF Clone FXC01510
Description chromosome 19 open reading frame 2
Features of the cloned cDNA sequence

Length: 2537 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 635 bp
Genome contig ID gi42406306f_35024998
PolyA signal sequence
(AGTAAA,-27)
+----*----+----*----+----*----+----
TTTTTCCAAGTAAAAACTTTATGAAACTTGGTCTC
Flanking genome sequence
(173455 - 173504)
----+----*----+----*----+----*----+----*----+----*
AAAAATGTTGTGAACTTTATGATTCAAAATTGAGTACAGATATGTCCTTG

Features of the protein sequence

Length: 566 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10940 2.1e-178 100.0 RNA polymerase ...
synthetic construct
XP_001148355 9.6e-178 97.4 RPB5-mediating ...
Pan troglodytes
O94763 1.2e-177 99.6 Unconventional ...
Homo sapiens
NP_003787 1.7e-177 99.6 unconventional ...
Homo sapiens
BAF84859 2.4e-177 99.4 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004127 69 189 PF02996 Prefoldin alpha-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp