Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01512
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01512
Clone name bm03987
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol KLC1
cDNA sequence DNA sequence (2467 bp)
Predicted protein sequence (630 aa)
Flexi ORF Clone FXC01512
Description Kinesin light chain 1 (KLC 1).
Features of the cloned cDNA sequence

Length: 2467 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 338 bp
Genome contig ID gi51511730f_103065314
PolyA signal sequence
(ATTAAA,-18)		 
+----*----+----*----+----*----+----
ATTGTACATTTTTTTAAATTAAAAGTTTATATGCC
Flanking genome sequence
(172319 - 172368)		 
----+----*----+----*----+----*----+----*----+----*
TTATGCTTTACTTGAAAGTTTTTATAAGACCTCTTAGAAGTGGGGGAAGG

Features of the protein sequence

Length: 630 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10943 2.9e-214 100.0 kinesin light c...
 synthetic construct
EAW81832 1.2e-212 99.6 kinesin 2, isof...
 Homo sapiens
DAA01289 1.3e-212 100.0 TPA_exp: kinesi...
 Homo sapiens
XP_001139413 1e-209 98.7 kinesin light c...
 Pan troglodytes
XP_854774 2.9e-209 98.3 similar to kine...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002151 120 137 PR00381 Kinesin light chain
IPR002151 218 237 PR00381 Kinesin light chain
IPR002151 240 258 PR00381 Kinesin light chain
IPR002151 305 322 PR00381 Kinesin light chain
IPR002151 349 369 PR00381 Kinesin light chain
IPR002151 384 405 PR00381 Kinesin light chain
HMMPfam IPR015390 92 266 PF09311 Rabaptin
IPR001440 267 300 PF00515 Tetratricopeptide TPR_1
IPR001440 309 342 PF00515 Tetratricopeptide TPR_1
IPR001440 351 384 PF00515 Tetratricopeptide TPR_1
IPR001440 393 426 PF00515 Tetratricopeptide TPR_1
IPR001440 476 496 PF00515 Tetratricopeptide TPR_1
HMMSmart IPR013026 267 300 SM00028 Tetratricopeptide region
IPR013026 309 342 SM00028 Tetratricopeptide region
IPR013026 351 384 SM00028 Tetratricopeptide region
IPR013026 393 426 SM00028 Tetratricopeptide region
IPR013026 476 509 SM00028 Tetratricopeptide region
ProfileScan IPR013026 225 258 PS50005 Tetratricopeptide region
IPR013026 225 426 PS50293 Tetratricopeptide region
IPR013026 267 300 PS50005 Tetratricopeptide region
IPR013026 309 342 PS50005 Tetratricopeptide region
IPR013026 351 384 PS50005 Tetratricopeptide region
IPR013026 393 426 PS50005 Tetratricopeptide region
IPR013026 476 509 PS50005 Tetratricopeptide region
IPR013026 476 509 PS50293 Tetratricopeptide region
ScanRegExp IPR015792 250 291 PS01160 Kinesin light chain
IPR015792 292 333 PS01160 Kinesin light chain
IPR015792 334 375 PS01160 Kinesin light chain
IPR015792 376 417 PS01160 Kinesin light chain
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp