Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01513
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01513
Clone name bm04309
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RNF11
cDNA sequence DNA sequence (2482 bp)
Predicted protein sequence (207 aa)
Flexi ORF Clone FXC01513
Description RING finger protein 11 (Sid 1669).
Features of the cloned cDNA sequence

Length: 2482 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1780 bp
Genome contig ID gi89161185f_51374780
PolyA signal sequence
(CATAAA,-19)
+----*----+----*----+----*----+----
TATATCCACCCAAGTACATAAAGCAAATTTGGAGG
Flanking genome sequence
(136584 - 136633)
----+----*----+----*----+----*----+----*----+----*
AAACAACTGAAGTTGTGCAATATTTTCTGATAATTGCTTTTTTTATTCTT

Features of the protein sequence

Length: 207 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001071243 2.3e-57 85.4 similar to RING...
Rattus norvegicus
AAG44245 4.6e-53 98.1 Nedd4 WW domain...
Mus musculus
Q9Y3C5 3.4e-51 100.0 RING finger pro...
Homo sapiens
AAP36265 3.4e-51 100.0 ring finger pro...
synthetic construct
Q9QYK7 3.8e-51 99.3 RING finger pro...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001841 152 192 PF00097 Zinc finger
HMMSmart IPR001841 152 192 SM00184 Zinc finger
ProfileScan IPR001841 152 192 PS50089 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp