ORK01514

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01514

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01514
Clone name	bm04544
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CCT4
cDNA sequence	DNA sequence (1989 bp) Predicted protein sequence (574 aa)
HaloTag ORF Clone	FHC01514
Flexi ORF Clone	FXC01514
Description	T-complex protein 1 subunit delta (TCP-1-delta) (CCT-delta) (Stimulator of TAR RNA-binding).

Features of the cloned cDNA sequence

Description

Length: 1989 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	262 bp
Genome contig ID	gi89161199r_61849069
PolyA signal sequence (AATAAA,-14)	+--------+--------+----*----+---- TTTGAAAAACTAATAAAAACTAATAAAAGAAGCGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAGTGAGTTTACATGTTGAGGAAAAAAATGGCCCAATATGCTCATCA

Features of the protein sequence

Description

Length: 574 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001152144	5.6e-214	99.3	chaperonin cont...	Pan troglodytes
P50991	1.1e-200	100.0	T-complex prote...	Homo sapiens
BAF83227	1.7e-200	99.8	unnamed protein...	Homo sapiens
Q5R637	2.2e-200	99.8	T-complex prote...	Pongo abelii
AAC50384	4e-200	99.8	stimulator of T...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002423	81	97	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	83	109	PR00298	Chaperonin Cpn60
	IPR002423	103	121	PR00304	Chaperonin Cpn60/TCP-1
	IPR002423	133	152	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	135	162	PR00298	Chaperonin Cpn60
	IPR002423	422	444	PR00304	Chaperonin Cpn60/TCP-1
	IPR001844	442	463	PR00298	Chaperonin Cpn60
	IPR002423	456	468	PR00304	Chaperonin Cpn60/TCP-1
HMMPfam	IPR002423	79	574	PF00118	Chaperonin Cpn60/TCP-1
HMMTigr	IPR012717	59	574	TIGR02342	T-complex protein 1
ScanRegExp	IPR002194	84	96	PS00750	Chaperonin TCP-1
	IPR002194	105	121	PS00751	Chaperonin TCP-1
	IPR002194	133	141	PS00995	Chaperonin TCP-1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp