ORK01515

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01515

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01515
Clone name	bm04608
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	USP11
cDNA sequence	DNA sequence (2793 bp) Predicted protein sequence (923 aa)
Flexi ORF Clone	FXC01515
Description	Ubiquitin carboxyl-terminal hydrolase 11 (EC 3.1.2.15) (Ubiquitin thioesterase 11) (Ubiquitin-specific-processing protease 11) (Deubiquitinating enzyme 11).

Features of the cloned cDNA sequence

Description

Length: 2793 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	21 bp
Genome contig ID	gi89161218f_46877378
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGATGTTAATTGAGAGCCCTGGGTCCTGCCACAG
Flanking genome sequence (114918 - 114967)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGCCCTCTCTGCAATCTCGCTTCTCGTGTCCGCCC

Features of the protein sequence

Description

Length: 923 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH63668	100.0	USP11 protein [...	Homo sapiens
AAI40850	100.0	Ubiquitin speci...	Homo sapiens
P51784	100.0	Ubiquitin carbo...	Homo sapiens
AAH00350	99.8	USP11 protein [...	Homo sapiens
CAH90661	99.3	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010460	104	246	PF06337	Ubiquitin carboxyl-terminal hydrolase
HMMPfam	IPR001394	266	887	PF00443	Peptidase C19
HMMSmart	IPR006615	55	147	SM00695	Ubiquitin carboxyl-terminal hydrolase
ProfileScan	IPR001394	269	891	PS50235	Peptidase C19
ScanRegExp	IPR001394	270	285	PS00972	Peptidase C19
ScanRegExp	IPR001394	832	849	PS00973	Peptidase C19

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp