Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01531
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01531
Clone name ef04346
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FLI1
cDNA sequence DNA sequence (2837 bp)
Predicted protein sequence (478 aa)
Flexi ORF Clone FXC01531
Description Friend leukemia integration 1 transcription factor (Fli-1 proto- oncogene) (ERGB transcription factor).
Features of the cloned cDNA sequence

Length: 2837 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1328 bp
Genome contig ID gi51511727f_127969278
PolyA signal sequence
(ATTAAA,-26)		 
+----*----+----*----+----*----+----
TTTTTAGACATTAAAATATATATAATTTTGCAGGT
Flanking genome sequence
(218145 - 218194)		 
----+----*----+----*----+----*----+----*----+----*
AATTGTTGACTTTTTTAACTATATTAAGTGTTAAGCTGACAACTGTCAAA

Features of the protein sequence

Length: 478 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q01543 1.1e-189 100.0 Friend leukemia...
 Homo sapiens
AAX36965 1.1e-189 100.0 Friend leukemia...
 synthetic construct
AAK50442 1.1e-189 100.0 his-tagged huma...
 synthetic construct
AAB23637 1.9e-189 99.7 Friend leukemia...
 Homo sapiens
AAX42357 2.2e-189 99.7 Friend leukemia...
 synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000418 307 320 PR00454 Ets
IPR000418 331 349 PR00454 Ets
IPR000418 350 368 PR00454 Ets
IPR000418 369 387 PR00454 Ets
HMMPfam IPR003118 140 224 PF02198 Sterile alpha motif/pointed
IPR000418 306 389 PF00178 Ets
HMMSmart IPR003118 140 224 SM00251 Sterile alpha motif/pointed
IPR000418 306 391 SM00413 Ets
ProfileScan IPR000418 307 387 PS50061 Ets
ScanRegExp IPR000418 309 317 PS00345 Ets
IPR000418 353 368 PS00346 Ets
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp