Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01536
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209881
Product ID ORK01536
Clone name ef06164
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CDKN1A
cDNA sequence DNA sequence (2108 bp)
Predicted protein sequence (191 aa)
Flexi ORF Clone FXC01536
Description Cyclin-dependent kinase inhibitor 1 (p21) (CDK-interacting protein 1) (Melanoma differentiation-associated protein 6) (MDA-6).
Features of the cloned cDNA sequence

Length: 2108 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1531 bp
Genome contig ID gi89161210f_36654477
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CAGCAGGTGCTCAATAAATGATTCTTAGTGACTTT
Flanking genome sequence
(108611 - 108660)
----+----*----+----*----+----*----+----*----+----*
ACTTGTAATATTACTATTGTGGTTATTATACCTTATAAGAACAAATAAAT

Features of the protein sequence

Length: 191 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93118 6.5e-79 100.0 Cyclin-dependen...
Homo sapiens
AAB59559 1.5e-74 99.4 cyclin-dependen...
Homo sapiens
AAB59560 4.9e-74 98.8 cyclin-dependen...
Homo sapiens
BAG10980 1.8e-67 100.0 cyclin-dependen...
synthetic construct
EAX03906 2.6e-67 98.7 cyclin-dependen...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003175 46 96 PF02234 Cyclin-dependent kinase inhibitor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp