ORK01539

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01539

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01539
Clone name	eg00157
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	NRP2
cDNA sequence	DNA sequence (6716 bp) Predicted protein sequence (950 aa)
HaloTag ORF Clone	FHC01539
Flexi ORF Clone	FXC01539
Description	Neuropilin-2 precursor (Vascular endothelial cell growth factor 165 receptor 2).

Features of the cloned cDNA sequence

Description

Length: 6716 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3081 bp
Genome contig ID	gi89161199f_206155406
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTAAGATTACTATTTAAATAAACATTATACCAGAG
Flanking genome sequence (215695 - 215744)	----+--------+--------+--------+--------+----* ATATTTTTCTGCATCGTGGTTTTTTTTTTTTTTTTTTTTCTCTGCATTGT

Features of the protein sequence

Description

Length: 950 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAG41897	100.0	neuropilin-2a(1...	Homo sapiens
AAC51789	99.8	neuropilin-2(a1...	Homo sapiens
O60462	99.4	Neuropilin-2; V...	Homo sapiens
XP_001136568	99.6	neuropilin 2 is...	Pan troglodytes
CAD97665	99.1	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000998	710	726	PR00020	MAM
	IPR000998	738	749	PR00020	MAM
	IPR000998	784	798	PR00020	MAM
	IPR000998	803	816	PR00020	MAM
HMMPfam	IPR000859	52	163	PF00431	CUB
	IPR000859	173	288	PF00431	CUB
	IPR000421	316	448	PF00754	Coagulation factor 5/8 type
	IPR000421	473	613	PF00754	Coagulation factor 5/8 type
	IPR000998	670	826	PF00629	MAM
HMMSmart	IPR000859	52	166	SM00042	CUB
	IPR000859	173	291	SM00042	CUB
	IPR000421	300	451	SM00231	Coagulation factor 5/8 type
	IPR000421	457	616	SM00231	Coagulation factor 5/8 type
	IPR000998	665	826	SM00137	MAM
ProfileScan	IPR000859	52	166	PS01180	CUB
	IPR000859	173	291	PS01180	CUB
	IPR000421	301	451	PS50022	Coagulation factor 5/8 type
	IPR000421	458	616	PS50022	Coagulation factor 5/8 type
	IPR000998	668	826	PS50060	MAM
ScanRegExp	IPR000421	341	370	PS01285	Coagulation factor 5/8 type
	IPR000421	435	451	PS01286	Coagulation factor 5/8 type
	IPR000421	497	529	PS01285	Coagulation factor 5/8 type
	IPR000421	599	616	PS01286	Coagulation factor 5/8 type

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	23	SKMDMFPLTWVFLALYFSRHQ	43	SECONDARY	21
SOSUI2	2	886	ITIIAMSSLGVLLGATCAGLLLY	908	PRIMARY	23