Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01544
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209907
Product ID ORK01544
Clone name eh00752
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PLD1
cDNA sequence DNA sequence (5855 bp)
Predicted protein sequence (1059 aa)
Flexi ORF Clone FXC01544
Description Phospholipase D1 (EC 3.1.4.4) (PLD 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D1) (hPLD1).
Features of the cloned cDNA sequence

Length: 5855 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2673 bp
Genome contig ID gi89161205r_172700889
PolyA signal sequence
(TATAAA,-19)		 
+----*----+----*----+----*----+----
ACTATTTTGAAATGCCTATAAATGCTATATACCTG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
ACATCCTGCTAATTTCTGTAATAATTTTTGTTTTCAAGAGGGAAAAATTC

Features of the protein sequence

Length: 1059 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93144 0 100.0 phospholipase D...
 Homo sapiens
XP_526380 0 99.7 phospholipase D...
 Pan troglodytes
BAG10992 0 100.0 phospholipase D...
 synthetic construct
O08684 0 91.5 Phospholipase D...
 Cricetulus griseus
AAI50124 0 92.1 PRKCSH protein ...
 Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001683 102 232 PF00787 Phox-like
IPR001849 243 351 PF00169 Pleckstrin-like
IPR001736 482 509 PF00614 Phospholipase D/Transphosphatidylase
IPR001736 876 903 PF00614 Phospholipase D/Transphosphatidylase
HMMSmart IPR001683 102 232 SM00312 Phox-like
IPR001849 243 353 SM00233 Pleckstrin-like
IPR001736 482 509 SM00155 Phospholipase D/Transphosphatidylase
IPR001736 876 903 SM00155 Phospholipase D/Transphosphatidylase
ProfileScan IPR001683 104 235 PS50195 Phox-like
IPR001736 482 509 PS50035 Phospholipase D/Transphosphatidylase
IPR001736 876 903 PS50035 Phospholipase D/Transphosphatidylase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp