Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01550
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01550
Clone name ej00608
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HIF1A
cDNA sequence DNA sequence (3839 bp)
Predicted protein sequence (834 aa)
Flexi ORF Clone FXC01550
Description hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)
Features of the cloned cDNA sequence

Length: 3839 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1174 bp
Genome contig ID gi51511730f_61132091
PolyA signal sequence
(AATAAA,-24)		 
+----*----+----*----+----*----+----
TTGTTACATCAAATAAACATCTTCTGTGGACCAGG
Flanking genome sequence
(152640 - 152689)		 
----+----*----+----*----+----*----+----*----+----*
CCCCTTTGATCAGCTTTTATGTTCAAATATTAATAATATTTGCTTCAACA

Features of the protein sequence

Length: 834 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q16665 0 100.0 Hypoxia-inducib...
 Homo sapiens
AAC68568 0 99.8 hypoxia-inducib...
 Homo sapiens
XP_001169001 0 99.8 hypoxia-inducib...
 Pan troglodytes
BAG35314 0 99.8 unnamed protein...
 Homo sapiens
EAW80806 0 99.7 hypoxia-inducib...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001321 209 232 PR01080 Hypoxia-inducible factor-1 alpha
IPR001321 368 386 PR01080 Hypoxia-inducible factor-1 alpha
IPR001321 425 443 PR01080 Hypoxia-inducible factor-1 alpha
IPR001321 465 485 PR01080 Hypoxia-inducible factor-1 alpha
HMMPfam IPR013655 260 353 PF08447 PAS fold-3
IPR014887 795 834 PF08778 HIF-1 alpha C terminal transactivation domain
HMMSmart IPR001092 31 86 SM00353 Basic helix-loop-helix dimerisation region bHLH
IPR000014 95 161 SM00091 PAS
IPR000014 238 304 SM00091 PAS
IPR001610 310 353 SM00086 PAC motif
ProfileScan IPR001092 24 79 PS50888 Basic helix-loop-helix dimerisation region bHLH
IPR000014 101 166 PS50112 PAS
IPR000014 255 306 PS50112 PAS
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp