Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01560
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01560
Clone name ek00129
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SMAD4
cDNA sequence DNA sequence (3490 bp)
Predicted protein sequence (558 aa)
Flexi ORF Clone FXC01560
Description Mothers against decapentaplegic homolog 4 (SMAD 4) (Mothers against DPP homolog 4) (Deletion target in pancreatic carcinoma 4) (hSMAD4).
Features of the cloned cDNA sequence

Length: 3490 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1309 bp
Genome contig ID gi51511735f_46710597
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TAGCTGGTAGCATAAATAAAACTGAATCTCAACAT
Flanking genome sequence
(149549 - 149598)
----+----*----+----*----+----*----+----*----+----*
ACAAAGTTGAATTCTAGGTTTGATTTTTAAGATTTTTTTTTTCTTTTGCA

Features of the protein sequence

Length: 558 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q13485 7.3e-210 100.0 Mothers against...
Homo sapiens
AAP88741 7.3e-210 100.0 MAD, mothers ag...
synthetic construct
AAL40861 2.2e-208 99.0 smad4 [Neovison...
Neovison vison
XP_001499937 3.3e-208 99.0 similar to smad...
Equus caballus
Q9GKQ9 4.9e-208 98.9 Mothers against...
Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003619 39 143 PF03165 MAD homology 1
IPR001132 323 538 PF03166 MAD homology 2
HMMSmart IPR003619 37 146 SM00523 MAD homology 1
IPR001132 327 536 SM00524 MAD homology 2
ProfileScan IPR013019 24 148 PS51075 MAD homology
IPR001132 329 558 PS51076 MAD homology 2
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp