Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01561
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226181
Product ID ORK01561
Clone name ek00226
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol DCAF6
cDNA sequence DNA sequence (3185 bp)
Predicted protein sequence (884 aa)
Flexi ORF Clone FXC01561
Description IQ motif and WD repeats 1 isoform b
Features of the cloned cDNA sequence

Length: 3185 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 398 bp
Genome contig ID gi89161185f_166072570
PolyA signal sequence
(ATTAAA,-24)		 
+----*----+----*----+----*----+----
GTTGCTTTCTAATTAAAGAAACTGGTTGTTTTAAG
Flanking genome sequence
(239127 - 239176)		 
----+----*----+----*----+----*----+----*----+----*
ATACCCTGAATTTGACTTTTTATTTAATGCCTTGCTACTTTGACCCACAG

Features of the protein sequence

Length: 884 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG11012 0 100.0 IQ motif and WD...
 synthetic construct
Q58WW2 0 99.8 DDB1- and CUL4-...
 Homo sapiens
XP_001174803 0 99.5 IQ motif and WD...
 Pan troglodytes
Q5R9B8 0 98.9 DDB1- and CUL4-...
 Pongo abelii
XP_001091583 0 98.7 similar to IQ m...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001680 71 101 PD000018 WD40 repeat
HMMPfam IPR001680 65 103 PF00400 WD40 repeat
IPR001680 108 144 PF00400 WD40 repeat
IPR001680 155 194 PF00400 WD40 repeat
IPR001680 205 244 PF00400 WD40 repeat
IPR000048 701 721 PF00612 IQ calmodulin-binding region
IPR001680 775 813 PF00400 WD40 repeat
HMMSmart IPR001680 64 103 SM00320 WD40 repeat
IPR001680 106 148 SM00320 WD40 repeat
IPR001680 154 194 SM00320 WD40 repeat
IPR001680 208 244 SM00320 WD40 repeat
IPR001680 262 305 SM00320 WD40 repeat
IPR001680 730 771 SM00320 WD40 repeat
IPR001680 774 813 SM00320 WD40 repeat
ProfileScan IPR001680 71 253 PS50294 WD40 repeat
IPR000048 700 727 PS50096 IQ calmodulin-binding region
IPR001680 737 822 PS50294 WD40 repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp