ORK01566

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01566

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01566
Clone name	ff02151
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CNTNAP5
cDNA sequence	DNA sequence (11184 bp) Predicted protein sequence (1351 aa)
HaloTag ORF Clone	FHC01566
Flexi ORF Clone	FXC01566
Description	contactin associated protein-like 5

Features of the cloned cDNA sequence

Description

Length: 11184 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	6909 bp
Genome contig ID	gi89161199f_124399347
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATAATGTATATTTAATAAAGAGAACATTTTGTATG
Flanking genome sequence (995902 - 995951)	----+--------+--------+--------+--------+----* ATTTTGTGTGGAAGACAAATGTGCCTTGCTGTGTTTTCTTGAGTTAATGA

Features of the protein sequence

Description

Length: 1351 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11023	100.0	contactin assoc...	synthetic construct
Q8WYK1	99.9	Contactin-assoc...	Homo sapiens
XP_001086018	98.3	similar to cont...	Macaca mulatta
XP_515771	95.1	contactin assoc...	Pan troglodytes
XP_001489255	94.1	contactin assoc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000421	86	215	PF00754	Coagulation factor 5/8 type
	IPR012680	253	382	PF02210	Laminin G
	IPR012680	440	566	PF02210	Laminin G
	IPR006209	595	627	PF00008	EGF-like
	IPR012680	864	983	PF02210	Laminin G
	IPR006209	1005	1039	PF00008	EGF-like
	IPR012680	1089	1218	PF02210	Laminin G
HMMSmart	IPR000421	73	218	SM00231	Coagulation factor 5/8 type
	IPR001791	245	382	SM00282	Laminin G
	IPR001791	432	566	SM00282	Laminin G
	IPR006210	594	628	SM00181	EGF
	IPR001791	856	983	SM00282	Laminin G
	IPR006210	1004	1040	SM00181	EGF
	IPR001791	1081	1218	SM00282	Laminin G
ProfileScan	IPR000421	74	218	PS50022	Coagulation factor 5/8 type
	IPR001791	224	405	PS50025	Laminin G
	IPR001791	412	589	PS50025	Laminin G
	IPR000742	591	628	PS50026	EGF-like
	IPR001791	836	1001	PS50025	Laminin G
	IPR000742	1002	1040	PS50026	EGF-like
	IPR001791	1058	1244	PS50025	Laminin G
ScanRegExp	IPR000421	200	218	PS01286	Coagulation factor 5/8 type

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1282	SAVIGGVIAVVIFIIFCIIGIMT	1304	PRIMARY	23