ORK01571

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01571

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01571
Clone name	fg03090
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RNF31
cDNA sequence	DNA sequence (6511 bp) Predicted protein sequence (1117 aa)
HaloTag ORF Clone	FHC01571
Flexi ORF Clone	FXC01571
Description	RING finger protein 31 (Zinc in-between-RING-finger ubiquitin- associated domain protein).

Features of the cloned cDNA sequence

Description

Length: 6511 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3121 bp
Genome contig ID	gi51511730f_23586577
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACTAAGGACTTAAAATAAAATTTTATTGAAAGAGG
Flanking genome sequence (119037 - 119086)	----+--------+--------+--------+--------+----* AATCAGTATCTGATTTTCTGGGAGAAGAAGGTAGCAGTGGTCACAGATAG

Features of the protein sequence

Description

Length: 1117 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96EP0	100.0	RING finger pro...	Homo sapiens
XP_001166497	99.5	ring finger pro...	Pan troglodytes
XP_001112195	98.1	interferon-stim...	Macaca mulatta
XP_001928270	92.1	ring finger pro...	Sus scrofa
XP_537383	92.4	similar to RING...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001876	395	424	PF00641	Zinc finger
HMMPfam	IPR000449	620	660	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR001876	347	371	SM00547	Zinc finger
	IPR001876	397	421	SM00547	Zinc finger
	IPR001876	456	480	SM00547	Zinc finger
	IPR002867	824	886	SM00647	Zinc finger
	IPR002867	898	975	SM00647	Zinc finger
ProfileScan	IPR001876	344	374	PS50199	Zinc finger
	IPR001876	395	424	PS50199	Zinc finger
	IPR000449	609	660	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR001876	349	368	PS01358	Zinc finger
	IPR001876	399	418	PS01358	Zinc finger
	IPR001876	458	477	PS01358	Zinc finger
	IPR001841	938	947	PS00518	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp