ORK01575

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01575

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01575
Clone name	sj07931
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SMAD7
cDNA sequence	DNA sequence (4352 bp) Predicted protein sequence (606 aa)
HaloTag ORF Clone	FHC01575
Flexi ORF Clone	FXC01575
Description	Mothers against decapentaplegic homolog 7 (SMAD 7) (Mothers against DPP homolog 7) (Smad7) (hSMAD7).

Features of the cloned cDNA sequence

Description

Length: 4352 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1511 bp
Genome contig ID	gi51511735r_44600229
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GGAGTTTATGTTCCATTAAACGATTTTTAAAATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACACTTGATTTCATGTTGTCCTCCAACTCCTTTTTCTTCTGCTGCTTGGA

Features of the protein sequence

Description

Length: 606 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL82858	3.4e-163	97.9	MAD homolog 7 (...	Rattus norvegicus
O15105	8e-147	100.0	Mothers against...	Homo sapiens
XP_512124	2.1e-146	99.7	MAD, mothers ag...	Pan troglodytes
AAB81354	2.9e-146	99.7	Smad7 protein [...	Homo sapiens
XP_001927617	2.9e-144	98.5	similar to Moth...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003619	269	382	PF03165	MAD homology 1
HMMPfam	IPR001132	435	606	PF03166	MAD homology 2
HMMSmart	IPR003619	267	385	SM00523	MAD homology 1
HMMSmart	IPR001132	439	604	SM00524	MAD homology 2
ProfileScan	IPR013019	244	387	PS51075	MAD homology
ProfileScan	IPR001132	441	606	PS51076	MAD homology 2

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp