ORK01578

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01578

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01578
Clone name	ff02842
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IGF1R
cDNA sequence	DNA sequence (11715 bp) Predicted protein sequence (1376 aa)
HaloTag ORF Clone	FHC01578
Flexi ORF Clone	FXC01578
Description	Insulin-like growth factor 1 receptor precursor (EC 2.7.10.1) (Insulin-like growth factor I receptor) (IGF-I receptor) (CD221 antigen) [Contains: Insulin-like growth factor 1 receptor alpha chain; Insulin-like growth factor 1 receptor beta chain].

Features of the cloned cDNA sequence

Description

Length: 11715 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	7085 bp
Genome contig ID	gi51511731f_96909796
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACATGGTTTAAGTTAAATAAAATAATTCTGTATGC
Flanking genome sequence (415487 - 415536)	----+--------+--------+--------+--------+----* ATTTCTGTCTCTGGTTTGGTTTTGTCCCTCCTGGAAGCATCACTACACTT

Features of the protein sequence

Description

Length: 1376 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11657	100.0	insulin-like gr...	Homo sapiens
P08069	99.8	Insulin-like gr...	Homo sapiens
AAB22215	99.7	insulin-like gr...	Homo sapiens
EAX02222	99.7	insulin-like gr...	Homo sapiens
XP_510613	99.6	insulin-like gr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1014	1268	PD000001	Protein kinase
FPrintScan	IPR001245	1088	1101	PR00109	Tyrosine protein kinase
	IPR001245	1134	1152	PR00109	Tyrosine protein kinase
	IPR001245	1183	1193	PR00109	Tyrosine protein kinase
	IPR001245	1202	1224	PR00109	Tyrosine protein kinase
	IPR001245	1246	1268	PR00109	Tyrosine protein kinase
HMMPfam	IPR000494	61	171	PF01030	EGF receptor
	IPR006211	185	343	PF00757	Furin-like cysteine rich region
	IPR000494	362	477	PF01030	EGF receptor
	IPR003961	499	597	PF00041	Fibronectin
	IPR003961	845	927	PF00041	Fibronectin
	IPR001245	1008	1275	PF07714	Tyrosine protein kinase
HMMSmart	IPR006212	237	280	SM00261	Furin-like repeat
	IPR003961	499	602	SM00060	Fibronectin
	IPR003961	621	824	SM00060	Fibronectin
	IPR003961	842	924	SM00060	Fibronectin
	IPR001245	1008	1275	SM00219	Tyrosine protein kinase
	IPR002290	1008	1276	SM00220	Serine/threonine protein kinase
ProfileScan	IPR003961	498	616	PS50853	Fibronectin
	IPR003961	621	699	PS50853	Fibronectin
	IPR003961	841	936	PS50853	Fibronectin
	IPR000719	1008	1283	PS50011	Protein kinase
ScanRegExp	IPR000719	1014	1042	PS00107	Protein kinase
	IPR008266	1140	1152	PS00109	Tyrosine protein kinase
	IPR002011	1168	1176	PS00239	Receptor tyrosine kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	19	SPTSLWGLLFLSAALSLWPTSGE	41	SECONDARY	23
SOSUI2	2	944	HLIIALPVAVLLIVGGLVIMLYV	966	PRIMARY	23