ORK01650

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01650

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01650
Clone name	ah01686
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CNTN2
cDNA sequence	DNA sequence (5222 bp) Predicted protein sequence (1054 aa)
HaloTag ORF Clone	FHC01650
Flexi ORF Clone	FXC01650
Description	Contactin-2 precursor (Axonin-1) (Axonal glycoprotein TAG-1) (Transient axonal glycoprotein 1) (TAX-1).

Features of the cloned cDNA sequence

Description

Length: 5222 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1870 bp
Genome contig ID	gi89161185f_203179003
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGTTTATGTTGATGTTTACCCACTACAATTTTTT
Flanking genome sequence (132385 - 132434)	----+--------+--------+--------+--------+----* AAAAATATAAGCTCACATGCCTTTTCCCTGCCACAGCCAAACCCCCACTG

Features of the protein sequence

Description

Length: 1054 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10266	100.0	contactin-2 pre...	synthetic construct
Q02246	99.8	Contactin-2; Ax...	Homo sapiens
1908253A	99.7	TAG-1 protein (...	Homo sapiens
BAF82674	99.7	unnamed protein...	Homo sapiens
AAI29987	99.7	Contactin 2 (ax...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013151	68	127	PF00047	Immunoglobulin
	IPR013151	268	322	PF00047	Immunoglobulin
	IPR013098	341	426	PF07679	Immunoglobulin I-set
	IPR013098	431	519	PF07679	Immunoglobulin I-set
	IPR013151	537	603	PF00047	Immunoglobulin
	IPR003961	622	711	PF00041	Fibronectin
	IPR003961	724	814	PF00041	Fibronectin
	IPR003961	826	914	PF00041	Fibronectin
HMMSmart	IPR003599	57	144	SM00409	Immunoglobulin subtype
	IPR003598	66	132	SM00408	Immunoglobulin subtype 2
	IPR003599	154	244	SM00409	Immunoglobulin subtype
	IPR003599	260	338	SM00409	Immunoglobulin subtype
	IPR003598	266	327	SM00408	Immunoglobulin subtype 2
	IPR003599	347	427	SM00409	Immunoglobulin subtype
	IPR003598	353	416	SM00408	Immunoglobulin subtype 2
	IPR003599	439	520	SM00409	Immunoglobulin subtype
	IPR003598	445	509	SM00408	Immunoglobulin subtype 2
	IPR003599	529	619	SM00409	Immunoglobulin subtype
	IPR003598	535	608	SM00408	Immunoglobulin subtype 2
	IPR003961	622	708	SM00060	Fibronectin
	IPR003961	725	811	SM00060	Fibronectin
	IPR003961	827	911	SM00060	Fibronectin
	IPR003961	927	1007	SM00060	Fibronectin
ProfileScan	IPR007110	57	142	PS50835	Immunoglobulin-like
	IPR007110	147	236	PS50835	Immunoglobulin-like
	IPR007110	253	336	PS50835	Immunoglobulin-like
	IPR007110	341	425	PS50835	Immunoglobulin-like
	IPR007110	431	518	PS50835	Immunoglobulin-like
	IPR007110	523	617	PS50835	Immunoglobulin-like
	IPR003961	621	717	PS50853	Fibronectin
	IPR003961	724	821	PS50853	Fibronectin
	IPR003961	826	922	PS50853	Fibronectin
	IPR003961	926	1016	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	23	PHLLLVAAVALVSSSAWSS	41	SECONDARY	19
SOSUI2	2	1033	PHPGTVISHSVAMLILIGSLEL	1054	PRIMARY	22