Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01652
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01652
Clone name bh00117
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ZNF521
cDNA sequence DNA sequence (4875 bp)
Predicted protein sequence (1337 aa)
Flexi ORF Clone FXC01652
Description zinc finger protein 521
Features of the cloned cDNA sequence

Length: 4875 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 785 bp
Genome contig ID gi51511735r_20795889
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
TGTTTTCCAAGAGGAAATAAATTCAGTTTACCATT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGGTATGAGTGTATTTGTGTGTTTTCTTTCTCTAGTTACTACACCATTAA

Features of the protein sequence

Length: 1337 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q96K83 0 100.0 Zinc finger pro...
 Homo sapiens
XP_512068 0 99.9 hypothetical pr...
 Pan troglodytes
BAF85756 0 99.8 unnamed protein...
 Homo sapiens
CAD57322 0 99.6 early hematopoi...
 Homo sapiens
XP_547633 0 99.0 similar to zinc...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 200 223 PD000003 Zinc finger
HMMPfam IPR007087 144 166 PF00096 Zinc finger
IPR007087 172 194 PF00096 Zinc finger
IPR007087 200 222 PF00096 Zinc finger
IPR007087 228 250 PF00096 Zinc finger
IPR007087 463 486 PF00096 Zinc finger
IPR007087 539 562 PF00096 Zinc finger
IPR007087 660 682 PF00096 Zinc finger
IPR007087 690 712 PF00096 Zinc finger
IPR007087 720 743 PF00096 Zinc finger
IPR007087 748 771 PF00096 Zinc finger
IPR007087 778 801 PF00096 Zinc finger
IPR007087 912 935 PF00096 Zinc finger
IPR007087 956 978 PF00096 Zinc finger
IPR007087 985 1007 PF00096 Zinc finger
IPR007087 1164 1187 PF00096 Zinc finger
IPR007087 1251 1273 PF00096 Zinc finger
IPR007087 1282 1305 PF00096 Zinc finger
IPR007087 1312 1335 PF00096 Zinc finger
HMMSmart IPR015880 73 93 SM00355 Zinc finger
IPR015880 144 166 SM00355 Zinc finger
IPR015880 172 194 SM00355 Zinc finger
IPR015880 200 222 SM00355 Zinc finger
IPR015880 228 250 SM00355 Zinc finger
IPR015880 272 295 SM00355 Zinc finger
IPR015880 307 330 SM00355 Zinc finger
IPR015880 336 358 SM00355 Zinc finger
IPR015880 431 455 SM00355 Zinc finger
IPR015880 463 486 SM00355 Zinc finger
IPR015880 503 526 SM00355 Zinc finger
IPR015880 539 562 SM00355 Zinc finger
IPR015880 586 611 SM00355 Zinc finger
IPR015880 660 682 SM00355 Zinc finger
IPR015880 690 712 SM00355 Zinc finger
IPR015880 720 743 SM00355 Zinc finger
IPR015880 748 771 SM00355 Zinc finger
IPR015880 778 801 SM00355 Zinc finger
IPR015880 809 831 SM00355 Zinc finger
IPR015880 835 858 SM00355 Zinc finger
IPR015880 912 935 SM00355 Zinc finger
IPR015880 956 978 SM00355 Zinc finger
IPR015880 985 1007 SM00355 Zinc finger
IPR015880 1014 1036 SM00355 Zinc finger
IPR015880 1046 1068 SM00355 Zinc finger
IPR015880 1164 1187 SM00355 Zinc finger
IPR015880 1221 1243 SM00355 Zinc finger
IPR015880 1251 1273 SM00355 Zinc finger
IPR015880 1282 1305 SM00355 Zinc finger
IPR015880 1312 1335 SM00355 Zinc finger
ProfileScan IPR007087 144 171 PS50157 Zinc finger
IPR007087 172 199 PS50157 Zinc finger
IPR007087 200 227 PS50157 Zinc finger
IPR007087 228 255 PS50157 Zinc finger
IPR007087 272 300 PS50157 Zinc finger
IPR007087 307 335 PS50157 Zinc finger
IPR007087 336 363 PS50157 Zinc finger
IPR007087 463 491 PS50157 Zinc finger
IPR007087 503 531 PS50157 Zinc finger
IPR007087 539 562 PS50157 Zinc finger
IPR007087 660 682 PS50157 Zinc finger
IPR007087 690 712 PS50157 Zinc finger
IPR007087 720 744 PS50157 Zinc finger
IPR007087 748 776 PS50157 Zinc finger
IPR007087 778 806 PS50157 Zinc finger
IPR007087 809 836 PS50157 Zinc finger
IPR007087 835 858 PS50157 Zinc finger
IPR007087 912 939 PS50157 Zinc finger
IPR007087 956 983 PS50157 Zinc finger
IPR007087 985 1012 PS50157 Zinc finger
IPR007087 1164 1192 PS50157 Zinc finger
IPR007087 1251 1278 PS50157 Zinc finger
IPR007087 1282 1310 PS50157 Zinc finger
IPR007087 1312 1337 PS50157 Zinc finger
ScanRegExp IPR007087 146 166 PS00028 Zinc finger
IPR007087 174 194 PS00028 Zinc finger
IPR007087 202 222 PS00028 Zinc finger
IPR007087 230 250 PS00028 Zinc finger
IPR007087 274 295 PS00028 Zinc finger
IPR007087 309 330 PS00028 Zinc finger
IPR007087 338 358 PS00028 Zinc finger
IPR007087 465 486 PS00028 Zinc finger
IPR007087 505 526 PS00028 Zinc finger
IPR007087 541 562 PS00028 Zinc finger
IPR007087 662 682 PS00028 Zinc finger
IPR007087 692 712 PS00028 Zinc finger
IPR007087 722 743 PS00028 Zinc finger
IPR007087 750 771 PS00028 Zinc finger
IPR007087 780 801 PS00028 Zinc finger
IPR007087 811 831 PS00028 Zinc finger
IPR007087 837 858 PS00028 Zinc finger
IPR007087 914 935 PS00028 Zinc finger
IPR007087 958 978 PS00028 Zinc finger
IPR007087 987 1007 PS00028 Zinc finger
IPR007087 1016 1036 PS00028 Zinc finger
IPR007087 1048 1068 PS00028 Zinc finger
IPR007087 1166 1187 PS00028 Zinc finger
IPR007087 1223 1243 PS00028 Zinc finger
IPR007087 1253 1273 PS00028 Zinc finger
IPR007087 1284 1305 PS00028 Zinc finger
IPR007087 1314 1335 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp