ORK01653

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01653

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01653
Clone name	af12940s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SPATA13
cDNA sequence	DNA sequence (8405 bp) Predicted protein sequence (1325 aa)
HaloTag ORF Clone	FHC01653
Flexi ORF Clone	FXC01653
Description	spermatogenesis associated 13

Features of the cloned cDNA sequence

Description

Length: 8405 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4293 bp
Genome contig ID	gi51511729f_23532905
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- ATATTTGTTGTTTTATATATTAAAATTCATTTGCC
Flanking genome sequence (246301 - 246350)	----+--------+--------+--------+--------+----* AAACTCGTTCTGATGATGCATTTGAGTAGCAGCCTTTAAAAGGAGGAAGT

Features of the protein sequence

Description

Length: 1325 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001152034	99.3	hypothetical pr...	Pan troglodytes
BAG11117	100.0	spermatogenesis...	synthetic construct
XP_001375757	67.9	hypothetical pr...	Monodelphis dom...
XP_906995	70.0	spermatogenesis...	Mus musculus
AAI38456	71.8	Spata13 protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	826	874	PD000066	Src homology-3
FPrintScan	IPR001452	837	852	PR00452	Src homology-3
	IPR001452	854	863	PR00452	Src homology-3
	IPR001452	865	877	PR00452	Src homology-3
HMMPfam	IPR001452	823	877	PF00018	Src homology-3
	IPR000219	917	1096	PF00621	DH
	IPR001849	1129	1234	PF00169	Pleckstrin-like
HMMSmart	IPR001452	823	878	SM00326	Src homology-3
	IPR000219	917	1096	SM00325	DH
	IPR001849	1129	1236	SM00233	Pleckstrin-like
ProfileScan	IPR001452	827	879	PS50002	Src homology-3
	IPR000219	913	1097	PS50010	DH
	IPR001849	1128	1234	PS50003	Pleckstrin-like
ScanRegExp	IPR000221	741	751	PS00048	Protamine P1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp