Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01676
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01676
Clone name fh21874
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol TTBK2
cDNA sequence DNA sequence (5232 bp)
Predicted protein sequence (1260 aa)
Flexi ORF Clone FXC01676
Description Tau-tubulin kinase 2 (EC 2.7.11.1).
Features of the cloned cDNA sequence

Length: 5232 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1447 bp
Genome contig ID gi51511731r_40723838
PolyA signal sequence
(AATACA,-21)
+----*----+----*----+----*----+----
TTGCTGCCAAACCTAATACAGTTGAATTGGGAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGAAAGGAATACATTTCCTCCCCAAGTGAACATCTTCTAAT

Features of the protein sequence

Length: 1260 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH71556 0 100.0 TTBK2 protein [...
Homo sapiens
XP_001155217 0 99.9 tau tubulin kin...
Pan troglodytes
Q6IQ55 0 99.9 Tau-tubulin kin...
Homo sapiens
XP_001155158 0 99.9 tau tubulin kin...
Pan troglodytes
BAD18523 0 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 89 271 PD000001 Protein kinase
HMMPfam IPR000719 37 243 PF00069 Protein kinase
HMMSmart IPR001245 37 278 SM00219 Tyrosine protein kinase
IPR002290 37 296 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 37 300 PS50011 Protein kinase
ScanRegExp IPR000719 43 66 PS00107 Protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp