Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01682
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01682
Clone name sj00220
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PLEKHG1
cDNA sequence DNA sequence (4537 bp)
Predicted protein sequence (1454 aa)
Flexi ORF Clone FXC01682
Description Pleckstrin homology domain-containing family G member 1.
Features of the cloned cDNA sequence

Length: 4537 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 108 bp
Genome contig ID gi89161210f_150946498
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
TTATGTATACCAGATTAAAACAATTTTGTAAGAAC
Flanking genome sequence
(257337 - 257386)
----+----*----+----*----+----*----+----*----+----*
CAGAGGTGTAAAATATACTTTCTTTTACAGCACAACTTTTGGAAATGGCT

Features of the protein sequence

Length: 1454 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10439 0 100.0 pleckstrin homo...
synthetic construct
Q9ULL1 0 100.0 Pleckstrin homo...
Homo sapiens
XP_001135904 0 99.0 pleckstrin homo...
Pan troglodytes
XP_001098617 0 92.0 pleckstrin homo...
Macaca mulatta
XP_541152 0 84.2 similar to Plec...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 186 361 PF00621 DH
IPR001849 393 485 PF00169 Pleckstrin-like
HMMSmart IPR000219 186 361 SM00325 DH
IPR001849 393 487 SM00233 Pleckstrin-like
ProfileScan IPR000219 182 362 PS50010 DH
IPR001849 386 485 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp