ORK01689

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01689

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01689
Clone name	hk01703s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RRBP1
cDNA sequence	DNA sequence (5411 bp) Predicted protein sequence (1635 aa)
HaloTag ORF Clone	FHC01689
Flexi ORF Clone	FXC01689
Description	ribosome binding protein 1 homolog 180kDa (dog)

Features of the cloned cDNA sequence

Description

Length: 5411 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	501 bp
Genome contig ID	gi51511747r_17442325
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- GTGTTGATGCCATTAAAACCAACGTTGGTGCCCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCTGCGGTCTCGTCTGGTCTTCTGCTGGGGCTCCCCCACCCGCTGTTGG

Features of the protein sequence

Description

Length: 1635 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10454	100.0	ribosome-bindin...	synthetic construct
BAF73807	97.1	p180/ribosome r...	Homo sapiens
Q9P2E9	90.1	Ribosome-bindin...	Homo sapiens
Q99PL5	79.3	Ribosome-bindin...	Mus musculus
CAM26890	78.0	ribosome bindin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	466	665	PD028462	NULL
HMMPfam	IPR007794	108	251	PF05104	Ribosome receptor lysine or proline rich
	IPR002989	306	345	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	376	415	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	416	455	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	476	515	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	526	565	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	586	625	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	626	665	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	666	705	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	706	745	PF01469	Mycobacterial pentapeptide repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	83	TLGVVVFGGFMVVSAIGIFLVST	105	PRIMARY	23