Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01704
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209999
Product ID ORK01704
Clone name eg01036
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol KDM5A
cDNA sequence DNA sequence (6918 bp)
Predicted protein sequence (1731 aa)
Flexi ORF Clone FXC01704
Description Histone demethylase JARID1A (EC 1.14.11.-) (Jumonji/ARID domain- containing protein 1A) (Retinoblastoma-binding protein 2) (RBBP-2).
Features of the cloned cDNA sequence

Length: 6918 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1635 bp
Genome contig ID gi89161190r_163265
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CTTATTAGAAGGGGACTAATTTTTTTTTAAAGGAC
Flanking genome sequence
(99984 - 99935)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATGACTAAAAATAGTGTTTTGTCATCACTGTCTGGTGTCT

Features of the protein sequence

Length: 1731 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06081 0 100.0 JARID1A variant...
 Homo sapiens
BAG10524 0 100.0 histone demethy...
 synthetic construct
XP_584665 0 97.8 similar to reti...
 Bos taurus
Q3UXZ9 0 96.6 Lysine-specific...
 Mus musculus
XP_001914992 0 96.9 jumonji, AT ric...
 Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003349 61 105 PF02375 Transcription factor jumonji
IPR001606 122 230 PF01388 AT-rich interaction region
IPR001965 336 384 PF00628 Zinc finger
IPR013129 511 627 PF02373 Transcription factor jumonji
IPR004198 717 770 PF02928 Zinc finger
IPR013637 781 1113 PF08429 PLU-1-like
IPR001965 1204 1259 PF00628 Zinc finger
IPR001965 1650 1702 PF00628 Zinc finger
HMMSmart IPR003349 59 100 SM00545 Transcription factor jumonji
IPR001606 126 216 SM00501 AT-rich interaction region
IPR001965 336 382 SM00249 Zinc finger
IPR003347 478 644 SM00558 Transcription factor jumonji/aspartyl beta-hydroxylase
IPR001965 1204 1257 SM00249 Zinc finger
IPR001965 1655 1700 SM00249 Zinc finger
ProfileScan IPR003349 60 101 PS51183 Transcription factor jumonji
IPR001606 125 215 PS51011 AT-rich interaction region
IPR001965 334 384 PS50016 Zinc finger
IPR003347 478 644 PS51184 Transcription factor jumonji/aspartyl beta-hydroxylase
IPR001965 1202 1259 PS50016 Zinc finger
IPR001965 1648 1702 PS50016 Zinc finger
ScanRegExp IPR001965 337 381 PS01359 Zinc finger
IPR001965 1205 1256 PS01359 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp