ORK01706

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01706

Order Kazusa clone(s) from :

Accession No	AB210019
Product ID	ORK01706
Clone name	fk00577
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CELF1
cDNA sequence	DNA sequence (3044 bp) Predicted protein sequence (544 aa)
HaloTag ORF Clone	FHC01706
Flexi ORF Clone	FXC01706
Description	CUG triplet repeat RNA-binding protein 1 (CUG-BP1) (RNA-binding protein BRUNOL-2) (Deadenylation factor CUG-BP) (50 kDa Nuclear polyadenylated RNA-binding protein) (EDEN-BP).

Features of the cloned cDNA sequence

Description

Length: 3044 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	611 bp
Genome contig ID	gi51511727r_47348459
PolyA signal sequence (AATAAA,-9)	+--------+--------+----*----+---- ATGGGATTTTTTAAATAAATGCAAAAAATAAAAAT
Flanking genome sequence (99987 - 99938)	----+--------+--------+--------+--------+----* AAAAAAGAAAAAAGAAAACAAAAAAAAAAAAGAAAAAAATGCTAGGTTGG

Features of the protein sequence

Description

Length: 544 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE06101	4.5e-184	100.0	CUGBP1 variant ...	Homo sapiens
BAG10529	6.5e-173	100.0	CUG triplet rep...	synthetic construct
CAM15320	6.2e-172	99.4	CUG triplet rep...	Mus musculus
EDL79496	1e-171	99.2	CUG triplet rep...	Rattus norvegicus
EAW67908	1.3e-171	99.6	CUG triplet rep...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	77	143	PF00076	RNA recognition motif
	IPR000504	168	235	PF00076	RNA recognition motif
	IPR000504	461	532	PF00076	RNA recognition motif
HMMSmart	IPR000504	76	154	SM00360	RNA recognition motif
	IPR000504	167	242	SM00360	RNA recognition motif
	IPR000504	460	533	SM00360	RNA recognition motif
ProfileScan	IPR003616	7	23	PS50868	Post-SET zinc-binding region
	IPR000504	75	158	PS50102	RNA recognition motif
	IPR000504	166	246	PS50102	RNA recognition motif
	IPR000504	459	537	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp