ORK01707

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01707

Order Kazusa clone(s) from :

Accession No	AB290172
Product ID	ORK01707
Clone name	hh05223s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	KIF1A
cDNA sequence	DNA sequence (9162 bp) Predicted protein sequence (1797 aa)
HaloTag ORF Clone	FHC01707
Flexi ORF Clone	FXC01707
Description	kinesin family member 1A

Features of the cloned cDNA sequence

Description

Length: 9162 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3539 bp
Genome contig ID	gi89161199r_241201856
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AATTAAGAAATAAATGTGGCTCTTACTCAACACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCCATGGGCTCTGCTGTGGCTTTATTTGCGTGTTACGTGTGTTGCAGGG

Features of the protein sequence

Description

Length: 1797 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG06726	100.0	KIF1A variant p...	Homo sapiens
BAE06111	99.3	KIF1A variant p...	Homo sapiens
XP_606290	93.7	kinesin family ...	Bos taurus
EAW71215	93.9	kinesin family ...	Homo sapiens
Q12756	94.2	Kinesin-like pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	94	115	PR00380	Kinesin
	IPR001752	214	231	PR00380	Kinesin
	IPR001752	249	267	PR00380	Kinesin
	IPR001752	310	331	PR00380	Kinesin
HMMPfam	IPR001752	17	361	PF00225	Kinesin
	IPR000253	531	602	PF00498	Forkhead-associated
	IPR001849	1683	1780	PF00169	Pleckstrin-like
HMMSmart	IPR001752	9	368	SM00129	Kinesin
	IPR000253	530	587	SM00240	Forkhead-associated
	IPR001849	1683	1782	SM00233	Pleckstrin-like
ProfileScan	IPR001752	8	279	PS50067	Kinesin
	IPR000253	531	587	PS50006	Forkhead-associated
	IPR001849	1682	1780	PS50003	Pleckstrin-like
ScanRegExp	IPR001752	248	259	PS00411	Kinesin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp