Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01709
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01709
Clone name pj00650
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol EPN3
cDNA sequence DNA sequence (3649 bp)
Predicted protein sequence (638 aa)
Flexi ORF Clone FXC01709
Description Epsin-3 (EPS-15-interacting protein 3).
Features of the cloned cDNA sequence

Length: 3649 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1592 bp
Genome contig ID gi51511734f_45865102
PolyA signal sequence
(AGTAAA,-21)
+----*----+----*----+----*----+----
GCTCTGTGACCTTGAGTAAATTACTTACCCTCTCC
Flanking genome sequence
(111009 - 111058)
----+----*----+----*----+----*----+----*----+----*
ATGTCTCTGTGCCTGCGTTTCCTTACTTGTCAAACGGGATCAGAAGTTTC

Features of the protein sequence

Length: 638 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG10555 1.9e-194 100.0 epsin-3 [synthe...
synthetic construct
BAG59030 7.2e-179 96.3 unnamed protein...
Homo sapiens
BAE34326 2e-161 84.9 unnamed protein...
Mus musculus
Q4V882 1.9e-157 84.7 Epsin-3; EPS-15...
Rattus norvegicus
AAI10603 3.2e-145 95.6 EPN3 protein [H...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001026 50 173 PF01417 Epsin
IPR003903 241 258 PF02809 Ubiquitin interacting motif
HMMSmart IPR013809 51 177 SM00273 Epsin-like
ProfileScan IPR013809 45 177 PS50942 Epsin-like
IPR003903 242 261 PS50330 Ubiquitin interacting motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp