ORK01711

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01711

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01711
Clone name	fh12330
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	EPHA3
cDNA sequence	DNA sequence (5601 bp) Predicted protein sequence (982 aa)
HaloTag ORF Clone	FHC01711
Flexi ORF Clone	FXC01711
Description	Ephrin type-A receptor 3 precursor (EC 2.7.10.1) (Tyrosine-protein kinase receptor ETK1) (HEK) (HEK4) (Tyrosine-protein kinase TYRO4).

Features of the cloned cDNA sequence

Description

Length: 5601 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2651 bp
Genome contig ID	gi89161205f_89139591
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ATTTTTATAATAAACATAATGAAAATATTTTTTAC
Flanking genome sequence (474376 - 474425)	----+--------+--------+--------+--------+----* AGATTGGAATACAGAAGTGGTCTTTGAAGTTTTTTAAAAATATATAAAAC

Features of the protein sequence

Description

Length: 982 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P29320	100.0	Ephrin type-A r...	Homo sapiens
BAF84100	99.8	unnamed protein...	Homo sapiens
AAH63282	99.8	EPH receptor A3...	Homo sapiens
AAA58633	99.7	receptor protei...	Homo sapiens
XP_516601	99.4	ephrin receptor...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001090	36	202	PD001495	Ephrin receptor
BlastProDom	IPR000719	627	884	PD000001	Protein kinase
FPrintScan	IPR003962	450	459	PR00014	Fibronectin
	IPR003962	463	473	PR00014	Fibronectin
	IPR003962	486	504	PR00014	Fibronectin
	IPR003962	504	518	PR00014	Fibronectin
	IPR001245	698	711	PR00109	Tyrosine protein kinase
	IPR001245	735	753	PR00109	Tyrosine protein kinase
	IPR001245	785	795	PR00109	Tyrosine protein kinase
	IPR001245	804	826	PR00109	Tyrosine protein kinase
	IPR001245	848	870	PR00109	Tyrosine protein kinase
HMMPfam	IPR001090	28	201	PF01404	Ephrin receptor
	IPR003961	325	418	PF00041	Fibronectin
	IPR003961	436	520	PF00041	Fibronectin
	IPR001245	620	877	PF07714	Tyrosine protein kinase
	IPR011510	907	974	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001090	28	201	SM00615	Ephrin receptor
	IPR003961	325	417	SM00060	Fibronectin
	IPR003961	436	517	SM00060	Fibronectin
	IPR002290	620	881	SM00220	Serine/threonine protein kinase
	IPR001245	620	877	SM00219	Tyrosine protein kinase
	IPR001660	907	974	SM00454	Sterile alpha motif SAM
ProfileScan	IPR003961	324	428	PS50853	Fibronectin
	IPR003961	436	527	PS50853	Fibronectin
	IPR000719	620	881	PS50011	Protein kinase
	IPR001660	910	974	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR001426	182	202	PS00790	Receptor tyrosine kinase
	IPR001426	243	263	PS00791	Receptor tyrosine kinase
	IPR013032	256	269	PS01186	EGF-like region
	IPR000719	626	652	PS00107	Protein kinase
	IPR008266	741	753	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	LSILLLLSCSVLDSFGELIPQPS	26	SECONDARY	23
SOSUI2	2	543	MIAISAAVAIILLTVVIYVLIGR	565	PRIMARY	23