ORK01714

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01714

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01714
Clone name	fj13915
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAPK6
cDNA sequence	DNA sequence (4085 bp) Predicted protein sequence (749 aa)
HaloTag ORF Clone	FHC01714
Flexi ORF Clone	FXC01714
Description	Mitogen-activated protein kinase 6 (EC 2.7.11.24) (Extracellular signal-regulated kinase 3) (ERK-3) (MAP kinase isoform p97) (p97- MAPK).

Features of the cloned cDNA sequence

Description

Length: 4085 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1138 bp
Genome contig ID	gi51511731f_49998716
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CCCAAGGCAAGCATGAATAAAATTAGGTTAAACGT
Flanking genome sequence (146918 - 146967)	----+--------+--------+--------+--------+----* AGCATGTGGCATCGCAGTCTCTTAGAATTTGTTTCATCTATTTTATTTTA

Features of the protein sequence

Description

Length: 749 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q16659	100.0	Mitogen-activat...	Homo sapiens
BAG36392	99.8	unnamed protein...	Homo sapiens
AAH35492	99.8	Mitogen-activat...	Homo sapiens
AAX42704	99.8	mitogen-activat...	synthetic construct
AAX42593	99.7	mitogen-activat...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	48	256	PD000001	Protein kinase
FPrintScan	IPR008350	55	73	PR01771	ERK3/4 MAP kinase
	IPR008350	80	91	PR01771	ERK3/4 MAP kinase
	IPR008350	107	122	PR01771	ERK3/4 MAP kinase
	IPR008350	136	150	PR01771	ERK3/4 MAP kinase
	IPR008350	186	198	PR01771	ERK3/4 MAP kinase
	IPR008350	207	217	PR01771	ERK3/4 MAP kinase
	IPR008350	229	240	PR01771	ERK3/4 MAP kinase
	IPR008350	260	269	PR01771	ERK3/4 MAP kinase
	IPR008350	274	292	PR01771	ERK3/4 MAP kinase
HMMPfam	IPR000719	48	344	PF00069	Protein kinase
HMMSmart	IPR001245	48	299	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	48	344	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	48	344	PS50011	Protein kinase
ScanRegExp	IPR000719	54	78	PS00107	Protein kinase
ScanRegExp	IPR008271	176	188	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp