ORK01718

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01718

Order Kazusa clone(s) from :

Accession No	AB208796
Product ID	ORK01718
Clone name	fj16347
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TEK
cDNA sequence	DNA sequence (4444 bp) Predicted protein sequence (1157 aa)
HaloTag ORF Clone	FHC01718
Flexi ORF Clone	FXC01718
Description	Angiopoietin-1 receptor precursor (EC 2.7.10.1) (Tyrosine-protein kinase receptor TIE-2) (hTIE2) (Tyrosine-protein kinase receptor TEK) (p140 TEK) (Tunica interna endothelial cell kinase) (CD202b antigen).

Features of the cloned cDNA sequence

Description

Length: 4444 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	941 bp
Genome contig ID	gi89161216f_26999461
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CATGAGTGAATAAATGTCTTGCCTACTCACGTCTC
Flanking genome sequence (220712 - 220761)	----+--------+--------+--------+--------+----* ATCCAGGAGTGTGTCTCATAGCTATTGCCACATGTCCTTATTATACTTTA

Features of the protein sequence

Description

Length: 1157 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92033	100.0	TEK tyrosine ki...	Homo sapiens
EAW58571	100.0	TEK tyrosine ki...	Homo sapiens
Q02763	99.9	Angiopoietin-1 ...	Homo sapiens
CAI16055	99.9	TEK tyrosine ki...	Homo sapiens
AAH35514	99.8	TEK tyrosine ki...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	863	1129	PD000001	Protein kinase
FPrintScan	IPR001245	935	948	PR00109	Tyrosine protein kinase
	IPR001245	987	1005	PR00109	Tyrosine protein kinase
	IPR001245	1033	1043	PR00109	Tyrosine protein kinase
	IPR001245	1052	1074	PR00109	Tyrosine protein kinase
	IPR001245	1096	1118	PR00109	Tyrosine protein kinase
HMMPfam	IPR013111	257	284	PF07974	EGF
	IPR013111	348	373	PF07974	EGF
	IPR003961	477	562	PF00041	Fibronectin
	IPR003961	576	659	PF00041	Fibronectin
	IPR003961	672	757	PF00041	Fibronectin
	IPR001245	857	1125	PF07714	Tyrosine protein kinase
HMMSmart	IPR006210	252	285	SM00181	EGF
	IPR006210	300	332	SM00181	EGF
	IPR006210	343	374	SM00181	EGF
	IPR003961	477	561	SM00060	Fibronectin
	IPR003961	576	658	SM00060	Fibronectin
	IPR003961	672	754	SM00060	Fibronectin
	IPR001245	857	1125	SM00219	Tyrosine protein kinase
	IPR002290	857	1129	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000742	249	285	PS50026	EGF-like
	IPR007110	383	473	PS50835	Immunoglobulin-like
	IPR003961	478	570	PS50853	Fibronectin
	IPR003961	577	666	PS50853	Fibronectin
	IPR003961	672	763	PS50853	Fibronectin
	IPR000719	857	1129	PS50011	Protein kinase
ScanRegExp	IPR013032	273	284	PS00022	EGF-like region
	IPR013032	273	288	PS01186	EGF-like region
	IPR013032	320	331	PS00022	EGF-like region
	IPR013032	320	335	PS01186	EGF-like region
	IPR013032	362	373	PS00022	EGF-like region
	IPR013032	362	373	PS01186	EGF-like region
	IPR000719	863	888	PS00107	Protein kinase
	IPR008266	993	1005	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	781	LIAILGSAGMTCLTVLLAFLIIL	803	PRIMARY	23