Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01719
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208800
Product ID ORK01719
Clone name hh13481
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CPS1
cDNA sequence DNA sequence (5699 bp)
Predicted protein sequence (1510 aa)
Flexi ORF Clone FXC01719
Description Carbamoyl-phosphate synthase [ammonia], mitochondrial precursor (EC 6.3.4.16) (Carbamoyl-phosphate synthetase I) (CPSase I).
Features of the cloned cDNA sequence

Length: 5699 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1120 bp
Genome contig ID gi89161199f_210950678
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
ATTGTGAACTTTTAAATAAAATACTATTAAGAGGT
Flanking genome sequence
(301398 - 301447)		 
----+----*----+----*----+----*----+----*----+----*
AATGCAGTTGAATCTGGTTTTATTTTATGTTGCTGTACAAAAATCAGTTT

Features of the protein sequence

Length: 1510 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92037 0 100.0 carbamoyl-phosp...
 Homo sapiens
BAG10591 0 100.0 carbamoyl-phosp...
 synthetic construct
NP_001116105 0 99.8 carbamoyl-phosp...
 Homo sapiens
XP_001146541 0 99.5 carbamoyl-phosp...
 Pan troglodytes
P31327 0 99.9 Carbamoyl-phosp...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001317 230 244 PR00099 Carbamoyl-phosphate synthase
IPR001317 266 280 PR00099 Carbamoyl-phosphate synthase
IPR011702 269 278 PR00096 Glutamine amidotransferase superfamily
IPR011702 299 310 PR00096 Glutamine amidotransferase superfamily
IPR001317 299 315 PR00099 Carbamoyl-phosphate synthase
IPR001317 316 333 PR00099 Carbamoyl-phosphate synthase
IPR001317 341 352 PR00099 Carbamoyl-phosphate synthase
IPR011702 383 396 PR00096 Glutamine amidotransferase superfamily
IPR005483 444 458 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 473 483 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 596 608 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 630 649 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 665 682 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 722 751 PR00098 Carbamoyl-phosphate synthetase large chain
IPR005483 804 822 PR00098 Carbamoyl-phosphate synthetase large chain
HMMPfam IPR002474 54 203 PF00988 Carbamoyl-phosphate synthase
IPR000991 231 407 PF00117 Glutamine amidotransferase class-I
IPR005481 431 554 PF00289 Carbamoyl-phosphate synthetase large chain
IPR005479 556 788 PF02786 Carbamoyl-phosphate synthase L chain
IPR005480 849 972 PF02787 Carbamoyl-phosphate synthetase large chain
IPR005481 982 1096 PF00289 Carbamoyl-phosphate synthetase large chain
IPR005479 1098 1188 PF02786 Carbamoyl-phosphate synthase L chain
IPR011607 1383 1475 PF02142 MGS-like
HMMTigr IPR006274 56 410 TIGR01368 Carbamoyl-phosphate synthase
IPR006275 427 1487 TIGR01369 Carbamoyl-phosphate synthase
ProfileScan IPR011761 561 753 PS50975 ATP-grasp fold
IPR011761 1103 1294 PS50975 ATP-grasp fold
ScanRegExp IPR005479 592 606 PS00866 Carbamoyl-phosphate synthase L chain
IPR005479 722 729 PS00867 Carbamoyl-phosphate synthase L chain
IPR005479 1134 1148 PS00866 Carbamoyl-phosphate synthase L chain
IPR005479 1263 1270 PS00867 Carbamoyl-phosphate synthase L chain
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp