ORK01720

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01720

Order Kazusa clone(s) from :

Accession No	AB208811
Product ID	ORK01720
Clone name	fh03701
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SEC14L1
cDNA sequence	DNA sequence (5456 bp) Predicted protein sequence (723 aa)
HaloTag ORF Clone	FHC01720
Flexi ORF Clone	FXC01720
Description	SEC14-like protein 1.

Features of the cloned cDNA sequence

Description

Length: 5456 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3009 bp
Genome contig ID	gi51511734f_72548669
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TATTGTTATCAATAATAAATGTGAACTATTTAAAG
Flanking genome sequence (176107 - 176156)	----+--------+--------+--------+--------+----* AAAAGAATGTCTTTTTCTTATTGTGAAACAACAGTTTCCCTTGAAGAGTT

Features of the protein sequence

Description

Length: 723 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92048	100.0	Hypothetical pr...	Homo sapiens
EAW89469	100.0	SEC14-like 1 (S...	Homo sapiens
AAI43078	99.8	SEC14-like 1 (S...	synthetic construct
AAI42980	99.8	SEC14L1 protein...	Homo sapiens
XP_001155845	99.7	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006797	25	181	PF04707	MSF1
	IPR008273	254	321	PF03765	Cellular retinaldehyde-binding/triple function
	IPR001251	336	518	PF00650	Cellular retinaldehyde-binding/triple function
HMMSmart	IPR001251	327	500	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR006797	11	183	PS50904	MSF1
	IPR001251	327	503	PS50191	Cellular retinaldehyde-binding/triple function
	IPR009038	529	682	PS50866	GOLD

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp