Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01725
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01725
Clone name fj15818
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol OSBPL11
cDNA sequence DNA sequence (4597 bp)
Predicted protein sequence (772 aa)
Flexi ORF Clone FXC01725
Description Oxysterol-binding protein-related protein 11 (OSBP-related protein 11) (ORP-11).
Features of the cloned cDNA sequence

Length: 4597 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1659 bp
Genome contig ID gi89161205r_126630394
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GGAAAATTGACAAATAATAAAACTAGAGAACAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATAATGCTTCTGTCTCTTTTACGAATGGAGAGAGAAAGTTTATATTCAG

Features of the protein sequence

Length: 772 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9BXB4 0 100.0 Oxysterol-bindi...
Homo sapiens
XP_001169503 0 99.4 oxysterol-bindi...
Pan troglodytes
XP_001114179 0 97.6 similar to oxys...
Macaca mulatta
XP_001501614 0 95.4 oxysterol bindi...
Equus caballus
XP_870520 0 94.8 similar to oxys...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 88 180 PF00169 Pleckstrin-like
IPR000648 359 772 PF01237 Oxysterol-binding protein
HMMSmart IPR001849 84 182 SM00233 Pleckstrin-like
ProfileScan IPR001849 83 180 PS50003 Pleckstrin-like
ScanRegExp IPR000648 532 542 PS01013 Oxysterol-binding protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp