ORK01725

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01725

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01725
Clone name	fj15818
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	OSBPL11
cDNA sequence	DNA sequence (4597 bp) Predicted protein sequence (772 aa)
HaloTag ORF Clone	FHC01725
Flexi ORF Clone	FXC01725
Description	Oxysterol-binding protein-related protein 11 (OSBP-related protein 11) (ORP-11).

Features of the cloned cDNA sequence

Description

Length: 4597 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1659 bp
Genome contig ID	gi89161205r_126630394
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GGAAAATTGACAAATAATAAAACTAGAGAACAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATAATGCTTCTGTCTCTTTTACGAATGGAGAGAGAAAGTTTATATTCAG

Features of the protein sequence

Description

Length: 772 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BXB4	100.0	Oxysterol-bindi...	Homo sapiens
XP_001169503	99.4	oxysterol-bindi...	Pan troglodytes
XP_001114179	97.6	similar to oxys...	Macaca mulatta
XP_001501614	95.4	oxysterol bindi...	Equus caballus
XP_870520	94.8	similar to oxys...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	88	180	PF00169	Pleckstrin-like
HMMPfam	IPR000648	359	772	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	84	182	SM00233	Pleckstrin-like
ProfileScan	IPR001849	83	180	PS50003	Pleckstrin-like
ScanRegExp	IPR000648	532	542	PS01013	Oxysterol-binding protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp