Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01740
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226116
Product ID ORK01740
Clone name hj01740
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol OCRL
cDNA sequence DNA sequence (5175 bp)
Predicted protein sequence (963 aa)
Flexi ORF Clone FXC01740
Description Inositol polyphosphate 5-phosphatase OCRL-1 (EC 3.1.3.36) (Lowe oculocerebrorenal syndrome protein).
Features of the cloned cDNA sequence

Length: 5175 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2281 bp
Genome contig ID gi89161218f_128401913
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGCAAATTTTTTTCTGAATAAATATATGTTGTGTG
Flanking genome sequence
(152298 - 152347)
----+----*----+----*----+----*----+----*----+----*
AAAAAGCAAAGTGTGATTTTGGTGAGGAAGCACTCAGAAGGGAGGGCTTA

Features of the protein sequence

Length: 963 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAA59964 0 98.7 Lowe oculocereb...
Homo sapiens
1814461A 0 98.6 OCRL-1 gene.
Homo sapiens
BAG10681 0 100.0 inositol polyph...
synthetic construct
Q01968 0 99.8 Inositol polyph...
Homo sapiens
BAF85796 0 99.7 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005135 304 593 PF03372 Endonuclease/exonuclease/phosphatase
IPR000198 797 939 PF00620 RhoGAP
HMMSmart IPR000300 300 601 SM00128 Inositol polyphosphate related phosphatase
IPR000198 794 958 SM00324 RhoGAP
ProfileScan IPR000198 783 963 PS50238 RhoGAP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp