ORK01741

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01741

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01741
Clone name	hc00467
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	UHMK1
cDNA sequence	DNA sequence (2469 bp) Predicted protein sequence (422 aa)
HaloTag ORF Clone	FHC01741
Flexi ORF Clone	FXC01741
Description	Serine/threonine-protein kinase Kist (EC 2.7.11.1) (Kinase interacting with stathmin) (U2AF homology motif kinase 1).

Features of the cloned cDNA sequence

Description

Length: 2469 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1082 bp
Genome contig ID	gi89161185f_160634288
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGTGGGTCAAAAGAATTAGATGTACAGTGAAGGG
Flanking genome sequence (125760 - 125809)	----+--------+--------+--------+--------+----* AAAAGAAAAAAAATGGGCGAAGAGAGGGTGGAAAATAAAAGGATTCTTTT

Features of the protein sequence

Description

Length: 422 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q5RCY1	7.5e-165	100.0	Serine/threonin...	Pongo abelii
XP_001174268	1.1e-164	99.7	kinase interact...	Pan troglodytes
XP_001118183	1.1e-164	99.7	kinase interact...	Macaca mulatta
XP_536143	1.4e-164	99.5	similar to Seri...	Canis lupus fam...
XP_582577	2e-164	99.7	similar to KIS ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	142	241	PD000001	Protein kinase
HMMPfam	IPR000719	26	307	PF00069	Protein kinase
HMMPfam	IPR000504	348	404	PF00076	RNA recognition motif
HMMSmart	IPR001245	26	307	SM00219	Tyrosine protein kinase
	IPR002290	26	307	SM00220	Serine/threonine protein kinase
	IPR000504	323	405	SM00360	RNA recognition motif
ProfileScan	IPR000719	26	307	PS50011	Protein kinase
ProfileScan	IPR000504	327	402	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp