ORK01742

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01742

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01742
Clone name	hk01620
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DNM1L
cDNA sequence	DNA sequence (4397 bp) Predicted protein sequence (751 aa)
HaloTag ORF Clone	FHC01742
Flexi ORF Clone	FXC01742
Description	dynamin 1-like

Features of the cloned cDNA sequence

Description

Length: 4397 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation:

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2139 bp
Genome contig ID	gi89161190f_32623524
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTGTGTAAATAAAATTGCTGGTATGAAATGACACT
Flanking genome sequence (166228 - 166277)	----+--------+--------+--------+--------+----* AAAGTTTGTCAAAAAATGAATTCTTAACTTTTCTCCCAGAGAAAGGGAGA

Features of the protein sequence

Description

Length: 751 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92307	100.0	Dynamin-like pr...	Homo sapiens
BAG10687	100.0	dynamin-1-like ...	synthetic construct
XP_864961	99.1	similar to dyna...	Canis lupus fam...
BAE01651	98.2	unnamed protein...	Macaca fascicularis
EAW88522	98.2	dynamin 1-like,...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001401	38	56	PR00195	Dynamin
	IPR001401	63	80	PR00195	Dynamin
	IPR001401	162	179	PR00195	Dynamin
	IPR001401	212	230	PR00195	Dynamin
	IPR001401	231	247	PR00195	Dynamin
	IPR001401	254	273	PR00195	Dynamin
HMMPfam	IPR001401	41	243	PF00350	Dynamin
	IPR000375	252	543	PF01031	Dynamin central region
	IPR003130	654	745	PF02212	Dynamin GTPase effector
HMMSmart	IPR001401	14	281	SM00053	Dynamin
HMMSmart	IPR003130	654	745	SM00302	Dynamin GTPase effector
ScanRegExp	IPR001401	64	73	PS00410	Dynamin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp