ORK01745

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01745

Order Kazusa clone(s) from :

Accession No	AB209116
Product ID	ORK01745
Clone name	hh13050
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RPS6KA2
cDNA sequence	DNA sequence (5794 bp) Predicted protein sequence (806 aa)
HaloTag ORF Clone	FHC01745
Flexi ORF Clone	FXC01745
Description	Ribosomal protein S6 kinase alpha-2 (EC 2.7.11.1) (S6K-alpha 2) (90 kDa ribosomal protein S6 kinase 2) (p90-RSK 2) (Ribosomal S6 kinase 3) (RSK-3) (pp90RSK3) (MAP kinase-activated protein kinase 1c) (MAPKAPK1C).

Features of the cloned cDNA sequence

Description

Length: 5794 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3373 bp
Genome contig ID	gi89161210r_166642866
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AGATTTTTTTGAATAAACATGGTTTTATGAAGTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCTTTTTCTAGCCTAACAATAACCTTTGGACTTTCTGTGTTGTTACCA

Features of the protein sequence

Description

Length: 806 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92353	100.0	ribosomal prote...	Homo sapiens
BAG10710	100.0	ribosomal prote...	synthetic construct
BAB41150	98.0	hypothetical pr...	Macaca fascicularis
NP_001006933	97.4	ribosomal prote...	Homo sapiens
Q15349	99.0	Ribosomal prote...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	132	391	PD000001	Protein kinase
BlastProDom	IPR000719	488	744	PD000001	Protein kinase
HMMPfam	IPR000719	132	391	PF00069	Protein kinase
	IPR000961	411	455	PF00433	Protein kinase
	IPR000719	488	745	PF00069	Protein kinase
HMMSmart	IPR001245	132	385	SM00219	Tyrosine protein kinase
	IPR002290	132	391	SM00220	Serine/threonine protein kinase
	IPR000961	392	453	SM00133	Protein kinase
	IPR001245	488	751	SM00219	Tyrosine protein kinase
	IPR002290	488	745	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	132	391	PS50011	Protein kinase
ProfileScan	IPR000719	488	745	PS50011	Protein kinase
ScanRegExp	IPR000719	138	164	PS00107	Protein kinase
	IPR008271	253	265	PS00108	Serine/threonine protein kinase
	IPR000719	494	517	PS00107	Protein kinase
	IPR008271	601	613	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp