ORK01748

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01748

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01748
Clone name	fj00968
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DCLK2
cDNA sequence	DNA sequence (4235 bp) Predicted protein sequence (796 aa)
HaloTag ORF Clone	FHC01748
Flexi ORF Clone	FXC01748
Description	doublecortin-like kinase 2

Features of the cloned cDNA sequence

Description

Length: 4235 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1180 bp
Genome contig ID	gi89161207f_151118876
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AGTGTCCCCAACCTGCAATAAACTTTTCCCTCTTG
Flanking genome sequence (279159 - 279208)	----+--------+--------+--------+--------+----* AAAAAAAGTAATCAGGGATGGGCAAAGGTTTCTGTGCTGTTGTTTGGCTA

Features of the protein sequence

Description

Length: 796 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92418	100.0	Hypothetical pr...	Homo sapiens
Q8N568	100.0	Serine/threonin...	Homo sapiens
AAI72430	99.8	Doublecortin-li...	synthetic construct
XP_001150968	99.6	hypothetical pr...	Pan troglodytes
NP_001035351	99.7	serine/threonin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	424	680	PD000001	Protein kinase
HMMPfam	IPR003533	119	183	PF03607	Doublecortin
	IPR003533	244	305	PF03607	Doublecortin
	IPR000719	424	681	PF00069	Protein kinase
HMMSmart	IPR003533	97	188	SM00537	Doublecortin
	IPR003533	222	310	SM00537	Doublecortin
	IPR001245	424	681	SM00219	Tyrosine protein kinase
	IPR002290	424	681	SM00220	Serine/threonine protein kinase
ProfileScan	IPR003533	102	188	PS50309	Doublecortin
	IPR003533	227	310	PS50309	Doublecortin
	IPR000719	424	681	PS50011	Protein kinase
ScanRegExp	IPR000719	430	453	PS00107	Protein kinase
ScanRegExp	IPR008271	541	553	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp