ORK01751

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01751

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01751
Clone name	fj06773
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ATF2
cDNA sequence	DNA sequence (4160 bp) Predicted protein sequence (509 aa)
HaloTag ORF Clone	FHC01751
Flexi ORF Clone	FXC01751
Description	Cyclic AMP-dependent transcription factor ATF-2 (Activating transcription factor 2) (cAMP response element-binding protein CRE- BP1) (HB16).

Features of the cloned cDNA sequence

Description

Length: 4160 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2357 bp
Genome contig ID	gi89161199r_175545226
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TCAGAGAATAAATTCTATCTTTAAATTATGTTCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTGCTTGTTCTCTTACCTTTCCTTCATAAAGTAACATCACCAGATAA

Features of the protein sequence

Description

Length: 509 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAX11111	1.5e-150	100.0	activating tran...	Homo sapiens
BAE01543	2.6e-150	99.8	unnamed protein...	Macaca fascicularis
CAA33886	2.9e-150	99.8	unnamed protein...	Homo sapiens
XP_535970	5.1e-150	99.4	similar to acti...	Canis lupus fam...
XP_001499802	9.3e-148	97.8	activating tran...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	29	53	PF00096	Zinc finger
HMMPfam	IPR011616	354	418	PF00170	bZIP transcription factor
HMMSmart	IPR004827	354	418	SM00338	Basic-leucine zipper (bZIP) transcription factor
ProfileScan	IPR007087	29	53	PS50157	Zinc finger
ProfileScan	IPR004827	356	419	PS50217	Basic-leucine zipper (bZIP) transcription factor
ScanRegExp	IPR007087	31	53	PS00028	Zinc finger
ScanRegExp	IPR004827	361	376	PS00036	Basic-leucine zipper (bZIP) transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp