Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01767
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209293
Product ID ORK01767
Clone name fk07131
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SMARCC2
cDNA sequence DNA sequence (3815 bp)
Predicted protein sequence (1156 aa)
Flexi ORF Clone FXC01767
Description SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 2 (SWI/SNF complex 170 kDa subunit) (BRG1-associated factor 170).
Features of the cloned cDNA sequence

Length: 3815 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 344 bp
Genome contig ID gi89161190r_54743396
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CACCTCCCTCCAAACTACTGCATTTTCTATGGATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGTAGATTTTAAAAAGCCACATTGGAGCTCCCTT

Features of the protein sequence

Length: 1156 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92530 0 100.0 SWI/SNF-related...
Homo sapiens
BAD92243 0 99.9 SWI/SNF-related...
Homo sapiens
BAG10767 0 100.0 SWI/SNF-related...
synthetic construct
NP_001123892 0 99.9 SWI/SNF complex...
Homo sapiens
XP_509136 0 99.6 SWI/SNF-related...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007526 429 517 PF04433 SWIRM
IPR014778 633 678 PF00249 Myb
HMMSmart IPR000953 191 240 SM00298 Chromo
IPR001005 632 680 SM00717 SANT
ProfileScan IPR007526 429 526 PS50934 SWIRM
IPR001005 636 678 PS50090 SANT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp