ORK01778

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01778

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01778
Clone name	fk11141
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was inserted at the NotI site of the vector. The 3' end of the cDNA was ligated with the SalI adapter (5'CGGACGCGTG GGTCGA3') and inserted at the SalI site of the vector.
Symbol	GIT1
cDNA sequence	DNA sequence (3447 bp) Predicted protein sequence (774 aa)
HaloTag ORF Clone	FHC01778
Flexi ORF Clone	FXC01778
Description	G protein-coupled receptor kinase interacting ArfGAP 1

Features of the cloned cDNA sequence

Description

Length: 3447 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1121 bp
Genome contig ID	gi51511734r_24824725
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGAGAGGCAGACGGTGGGACCCACCAGCTCTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCCATCCCGCTTCTTCCCTGGGGGCCAGGCCCTACCTGTGTGGTGGTGGG

Features of the protein sequence

Description

Length: 774 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92774	100.0	G protein-coupl...	Homo sapiens
XP_511377	99.8	G protein-coupl...	Pan troglodytes
BAG10826	100.0	ARF GTPase-acti...	synthetic construct
Q68FF6	97.7	ARF GTPase-acti...	Mus musculus
XP_548300	98.9	similar to G pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001164	12	31	PR00405	Arf GTPase activating protein
	IPR001164	31	48	PR00405	Arf GTPase activating protein
	IPR001164	52	73	PR00405	Arf GTPase activating protein
HMMPfam	IPR001164	3	128	PF01412	Arf GTPase activating protein
	IPR002110	141	164	PF00023	Ankyrin
	IPR002110	170	202	PF00023	Ankyrin
	IPR002110	203	235	PF00023	Ankyrin
	IPR013724	277	307	PF08518	Spa2 homology (SHD) of GIT
	IPR013724	341	371	PF08518	Spa2 homology (SHD) of GIT
HMMSmart	IPR001164	3	128	SM00105	Arf GTPase activating protein
	IPR002110	136	165	SM00248	Ankyrin
	IPR002110	170	199	SM00248	Ankyrin
	IPR002110	203	232	SM00248	Ankyrin
	IPR013724	277	307	SM00555	Spa2 homology (SHD) of GIT
	IPR013724	341	371	SM00555	Spa2 homology (SHD) of GIT
ProfileScan	IPR001164	1	128	PS50115	Arf GTPase activating protein
	IPR002110	136	225	PS50297	Ankyrin
	IPR002110	170	202	PS50088	Ankyrin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp